ID: 1059542310

View in Genome Browser
Species Human (GRCh38)
Location 9:115143113-115143135
Sequence CTGTGTGAACACAGGGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059542304_1059542310 23 Left 1059542304 9:115143067-115143089 CCTGTGGTCAGTGGGCAGGAGAG 0: 1
1: 0
2: 1
3: 32
4: 330
Right 1059542310 9:115143113-115143135 CTGTGTGAACACAGGGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059542310 Original CRISPR CTGTGTGAACACAGGGAAAA AGG Intronic
No off target data available for this crispr