ID: 1059544200

View in Genome Browser
Species Human (GRCh38)
Location 9:115160106-115160128
Sequence CATGGCACTCGGCAAATACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059544200_1059544204 -4 Left 1059544200 9:115160106-115160128 CCTGGTATTTGCCGAGTGCCATG No data
Right 1059544204 9:115160125-115160147 CATGGAGATGAGAGCTACCATGG No data
1059544200_1059544205 4 Left 1059544200 9:115160106-115160128 CCTGGTATTTGCCGAGTGCCATG No data
Right 1059544205 9:115160133-115160155 TGAGAGCTACCATGGACAAAAGG No data
1059544200_1059544209 26 Left 1059544200 9:115160106-115160128 CCTGGTATTTGCCGAGTGCCATG No data
Right 1059544209 9:115160155-115160177 GATGGTCACCCAATCCTCGGTGG No data
1059544200_1059544208 23 Left 1059544200 9:115160106-115160128 CCTGGTATTTGCCGAGTGCCATG No data
Right 1059544208 9:115160152-115160174 AAGGATGGTCACCCAATCCTCGG No data
1059544200_1059544206 8 Left 1059544200 9:115160106-115160128 CCTGGTATTTGCCGAGTGCCATG No data
Right 1059544206 9:115160137-115160159 AGCTACCATGGACAAAAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059544200 Original CRISPR CATGGCACTCGGCAAATACC AGG (reversed) Intronic