ID: 1059545372

View in Genome Browser
Species Human (GRCh38)
Location 9:115170704-115170726
Sequence CTGTAGCCACCAGGGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 255}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059545372_1059545377 -7 Left 1059545372 9:115170704-115170726 CCCTGCTCCCCTGGTGGCTACAG 0: 1
1: 0
2: 0
3: 16
4: 255
Right 1059545377 9:115170720-115170742 GCTACAGAAGTACAGTTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059545372 Original CRISPR CTGTAGCCACCAGGGGAGCA GGG (reversed) Intronic
900093760 1:931933-931955 CTGTGGCTTCCAGGGCAGCAAGG + Intronic
901028969 1:6295094-6295116 CCGCAGCCAGCAGGGGTGCAGGG + Intronic
901197782 1:7449891-7449913 ATGCAGCCCCCAGGGGAGAAAGG + Intronic
901489749 1:9590542-9590564 CTGTGGCCAGCAGGGCAGGAAGG - Intronic
902226137 1:14997575-14997597 CTGTCGGCTCCAGGAGAGCAGGG + Intronic
902746920 1:18480743-18480765 CCCCAGCCACCAGGGAAGCATGG + Intergenic
903295973 1:22343220-22343242 CTGTGGCCACCTGGCCAGCAGGG - Intergenic
904033207 1:27545955-27545977 CTTCAGGCACCAGGGGAGCTGGG + Intronic
906511819 1:46414332-46414354 CTGTGGCCAGCACGGCAGCAGGG + Intergenic
907888073 1:58612289-58612311 CTGGATCCACAAGGGGATCATGG - Intergenic
912546888 1:110457409-110457431 CTGTGGCAACCTGGGGAGGAAGG + Intergenic
913454814 1:119020000-119020022 CTGTACTCACTAGAGGAGCATGG + Intergenic
918005404 1:180537140-180537162 CCGCAGCCACCAGAGGAGGAAGG + Intergenic
919016865 1:192049589-192049611 TTGTAGCCATCAGGGCATCATGG - Intergenic
920181603 1:204135213-204135235 CTCTAGCCACAAGGAGAGCACGG - Intronic
920379214 1:205526198-205526220 CTGAAGCCCCCAGGGGAGCGTGG - Intronic
920617006 1:207503459-207503481 GTGGAGGCTCCAGGGGAGCAGGG + Intronic
923632446 1:235660344-235660366 CTGTAACCTCCAGGAGTGCAGGG + Intergenic
924328035 1:242915000-242915022 ATGCAGACACCACGGGAGCAGGG + Intergenic
1063489016 10:6446479-6446501 CTTTAGCCTCCTGGGGAGCTGGG + Intronic
1063979835 10:11444478-11444500 CCTGAGCCACCAGGTGAGCAGGG + Intergenic
1064207285 10:13335012-13335034 CTGTAGTCATCAGTGGTGCATGG - Intronic
1065039022 10:21671835-21671857 CTGTAGCCTCCTGAGGAGCTGGG - Intronic
1065349740 10:24784807-24784829 ATGTGACCACCAGGGGACCACGG - Intergenic
1067693835 10:48521304-48521326 TTGCAGCCAGCAGGAGAGCAAGG + Intronic
1067942269 10:50667181-50667203 CTGATGGCCCCAGGGGAGCATGG - Intergenic
1068253181 10:54470372-54470394 CAGTAGCCACCAGTGGTGCCTGG + Intronic
1069425091 10:68281491-68281513 AAGTAGCCACCAGAGAAGCAGGG - Intergenic
1069745625 10:70713227-70713249 GTGAAGCCAGCTGGGGAGCAGGG - Intronic
1069877787 10:71573810-71573832 CTGTGGGCCCCAGGGGAGCCGGG - Intronic
1070408623 10:76118916-76118938 CTGCAGCTACCAGGGCACCAGGG - Intronic
1070644801 10:78194549-78194571 CTGTAAGCTCCAGGGCAGCAGGG - Intergenic
1070863514 10:79692139-79692161 CTGATGGCCCCAGGGGAGCATGG - Intergenic
1071702532 10:87955554-87955576 CTGAAGGCAAAAGGGGAGCATGG + Intronic
1074011919 10:109490777-109490799 CTGCAGCCACCAGAGTAGCTGGG - Intergenic
1074567286 10:114592067-114592089 ATGTAGGCACCAGTGGGGCAGGG - Intronic
1076403256 10:130196839-130196861 CTGCTGCTACCAGGAGAGCAGGG - Intergenic
1076810658 10:132884785-132884807 CTGGTGCCACCAGGGGAGCCTGG + Intronic
1077009480 11:373836-373858 CAGAAGCCCCCAGGGGAGGAAGG - Intronic
1077047417 11:552610-552632 CTGTAGCCCCCTGGGGCCCACGG + Exonic
1078760719 11:14249242-14249264 CTCTGGCCTCCTGGGGAGCATGG - Intronic
1079396020 11:20064351-20064373 CTGTAGGCACCAGAGGGACATGG + Intronic
1081054275 11:38388535-38388557 CTGTGGCCAGCAGGGGAGAATGG - Intergenic
1081579673 11:44343613-44343635 CTGCAGCAGCCAGGGCAGCAGGG + Intergenic
1083169036 11:60911376-60911398 CTGTTGCTGCCTGGGGAGCATGG + Intergenic
1083688380 11:64391420-64391442 CAGTAGCCACCTGTGGAGCCTGG + Intergenic
1083803924 11:65062537-65062559 CTGTGGACAGCTGGGGAGCAGGG - Intergenic
1084157672 11:67323282-67323304 CTGAAGGCACCAGGGGCCCAGGG + Intronic
1084447481 11:69212286-69212308 CTGGAGCCCCCAGGGCAGGAGGG - Intergenic
1085390939 11:76181857-76181879 CTGTGGGCACCAGGGCAGCAAGG - Intergenic
1087007429 11:93483484-93483506 TTGTAGTCACCAGGGAAGCCAGG + Intronic
1089297373 11:117478219-117478241 CTGTGGGCATCAGGGCAGCATGG + Intronic
1089352714 11:117830540-117830562 ATGTAAGCACCAGGAGAGCAAGG + Intronic
1089489127 11:118870726-118870748 CAGTAGCCAGCAGGGGACCCTGG + Intergenic
1089625709 11:119749388-119749410 CAGGCGCCACCAGGGGTGCAGGG + Intergenic
1093462911 12:19422404-19422426 AAGTAGCCACCTGGGGAGTATGG - Intronic
1095955619 12:47804051-47804073 CTGTGGTTACCAGGGGAGCAAGG - Intronic
1096561796 12:52440820-52440842 CTGGAGCCAGCAGGAGAGCAAGG - Intergenic
1098427634 12:70383594-70383616 CTAGAGCCTTCAGGGGAGCATGG - Intronic
1101089966 12:101275205-101275227 CTGTAGCTACCAGGGAGGCTGGG + Intergenic
1101152917 12:101900113-101900135 ATGTAGCCTCCATGAGAGCAGGG - Intronic
1102689526 12:114749508-114749530 CAGCAGCCACCAGGGAAACATGG - Intergenic
1105585810 13:21741707-21741729 CTAGAGCCTCCAGAGGAGCAGGG + Intergenic
1106029538 13:25987646-25987668 CTGTAGCCACCAGCCATGCAGGG + Intronic
1107884810 13:44866336-44866358 GTGTTGCCTCCAGGGGGGCAGGG + Intergenic
1110338433 13:74360252-74360274 CTGCATCCACCAGGTGATCAAGG - Intergenic
1113471284 13:110548561-110548583 ATGAAGGCACCAGGGGAGCGCGG + Intronic
1114531940 14:23402006-23402028 CAGTAGCCACCAGAGGAGTGAGG + Intronic
1115872714 14:37823235-37823257 CTGTGGACACCAGGAGAGGAGGG - Intronic
1118085387 14:62409334-62409356 CTGATGCCACCAGCAGAGCAGGG - Intergenic
1120863205 14:89273520-89273542 CTGTAGCCACTGGGGAAGAAGGG + Intronic
1121328864 14:93037086-93037108 CAGGAGCCACCCAGGGAGCAGGG - Intronic
1121575807 14:94986000-94986022 CTATAGTCACCAAGGCAGCATGG + Intergenic
1123846371 15:24306650-24306672 CTGCAGCCTCCAGAGGAGCTGGG + Intergenic
1124158758 15:27250823-27250845 CTGAGGCCACCAGGGTGGCAAGG + Intronic
1124374165 15:29120141-29120163 CAGTAGCCAGCCGGGGAGCCTGG - Intergenic
1124376665 15:29133052-29133074 CTGTAGCCAGCAGGGGCACCGGG - Intronic
1124946294 15:34270201-34270223 CTGTAGCCTCCAGAGTAGCTAGG + Intronic
1126310539 15:47311425-47311447 TTGGAGCCAACAGGGGATCATGG + Intronic
1127598813 15:60514464-60514486 ATGTAGCTGCCAGAGGAGCATGG + Intronic
1128366155 15:67004840-67004862 CTGCAGGCACCAGGAGACCATGG - Intergenic
1129274395 15:74435445-74435467 CTGAAGCCAGCAGTGGAGCCTGG + Intergenic
1129455731 15:75675416-75675438 CTGGAGACACCAGGGGTGGAGGG - Exonic
1132801641 16:1757630-1757652 CTGAAGTCACAATGGGAGCAAGG - Intronic
1133286299 16:4692385-4692407 CTGTGGCCACCAGTGGGTCAGGG - Intergenic
1133317428 16:4893256-4893278 CTGCGGCCACCACTGGAGCAAGG - Exonic
1134314585 16:13106812-13106834 GTGTAGCCACCAGGTGGGAAAGG + Intronic
1137512375 16:49113000-49113022 CTGCAGCCAGCAAGGAAGCAGGG - Intergenic
1137747072 16:50830299-50830321 CGGCAGCCACCAGGAGAGGAAGG + Intergenic
1138103527 16:54273987-54274009 CTGAAGGCACCAGGAAAGCAGGG + Intergenic
1138539043 16:57677248-57677270 CTGTAGCCCTTAGGGGAACAGGG + Intronic
1139613302 16:68074224-68074246 CTGACTCCACCAGGGGACCAGGG + Intronic
1140594215 16:76390072-76390094 ATGTATCCATCAGAGGAGCAAGG + Intronic
1140697548 16:77549964-77549986 CTGCAAGCTCCAGGGGAGCAGGG - Intergenic
1142265739 16:89063309-89063331 AGGTAGGCATCAGGGGAGCAGGG - Intergenic
1142664531 17:1455410-1455432 CAAAGGCCACCAGGGGAGCACGG + Intronic
1142708882 17:1712896-1712918 CTGTAGCCGCTAGGTGAGAATGG + Intergenic
1143122765 17:4619268-4619290 CTGTAGCCTCCAGAGTAGCTGGG + Intergenic
1143532423 17:7513068-7513090 GTGTAGCCCCCAGGAGAGCGGGG - Exonic
1143582037 17:7833326-7833348 CTGGAGCCTCCGGGAGAGCAGGG - Intronic
1144528657 17:16014063-16014085 TTTCAACCACCAGGGGAGCATGG - Intronic
1144673145 17:17144203-17144225 CTTCAGCCTCCAGGGGAGCCTGG + Intronic
1145272324 17:21411349-21411371 CTGTGGCCAGCAGGAAAGCAGGG + Intronic
1145301854 17:21646377-21646399 CTGGACCCACCAGTGCAGCAGGG - Intergenic
1145310530 17:21698814-21698836 CTGTGGCCAGCAGGAAAGCAGGG + Intronic
1145348458 17:22056942-22056964 CTGGACCCACCAGTGCAGCAGGG + Intergenic
1146923694 17:36730059-36730081 CTGCAGCCATCAGGGGAAGAGGG + Intergenic
1147553230 17:41460033-41460055 CAGTGGCCACCAGAAGAGCAGGG - Exonic
1149826841 17:59836311-59836333 CTGTAGCCTCCTGAGTAGCAGGG + Intronic
1150220150 17:63491469-63491491 CTGGAGCCAGCAGGGCAGGATGG + Intronic
1150224379 17:63515564-63515586 CTGTAGCCACCAGGCCAGATGGG + Intronic
1150295216 17:64003776-64003798 CTGTGGCCTCCTGCGGAGCAGGG + Exonic
1151817105 17:76476794-76476816 CTGGAGCCCCCAGGAGAGCCTGG - Intronic
1152826076 17:82465679-82465701 CTGTAGCCTCCAGAGCAGCTGGG + Intronic
1152961350 18:82162-82184 CTGTGGGGACCAGGGGACCAGGG + Intergenic
1153046157 18:857264-857286 CTGTGGCCTACAGGAGAGCATGG + Intergenic
1158373837 18:56840701-56840723 CTGTAGCCTCCAGAGTAGCTGGG - Intronic
1160016297 18:75143285-75143307 CTGAAGCCTCCTGGGGAGGAAGG + Intergenic
1160424302 18:78769657-78769679 CTCCAGCCACCAGGGCACCAGGG - Intergenic
1160670100 19:358023-358045 CTTCAGCCACCAGGGTAGCTGGG - Intergenic
1160704682 19:524442-524464 ATGAAGCCACCAGAGGAGCTGGG - Intergenic
1160727824 19:625334-625356 CTGTAGCCACCAGCTCAGCAGGG + Intronic
1163300511 19:16442766-16442788 CTGTTCCCACCAGGGAAGGAAGG + Intronic
1163379758 19:16957496-16957518 CTGTAGTCCCCTGAGGAGCAAGG + Intronic
1165145461 19:33727324-33727346 CTGCAGCCACCACGGGAGGCTGG - Intronic
1165475349 19:36027046-36027068 CTGTGAGTACCAGGGGAGCAGGG + Intronic
1165937616 19:39398652-39398674 CTGAAGCTTCCAGGGAAGCAGGG - Exonic
1166137105 19:40784154-40784176 CTGTACCCAGCAGGGGAACGTGG + Intronic
925471906 2:4172240-4172262 CTGGAGCCCTCAGAGGAGCAGGG + Intergenic
925575141 2:5352429-5352451 TTGTAACCAGCAGGGGAGAATGG + Intergenic
925855631 2:8126494-8126516 CTGTGACCTCCAAGGGAGCAGGG + Intergenic
925913360 2:8587484-8587506 CTGTGGCCACCGCGGCAGCACGG + Intergenic
927938217 2:27087097-27087119 CTGCAGCGGCCAGGGGTGCAGGG - Exonic
929561185 2:42957581-42957603 CTGTGGCCATCTGGGGAGCCAGG - Intergenic
931166835 2:59757714-59757736 CAGTGGCCCCCAGGGGAGCAGGG - Intergenic
934160155 2:89242024-89242046 CTGAAGCCATGAGGGCAGCAGGG + Intergenic
934207120 2:89940410-89940432 CTGAAGCCATGAGGGCAGCAGGG - Intergenic
934565674 2:95339235-95339257 CTTCAGCCACAAGGGGAGCCAGG + Intronic
934753779 2:96811075-96811097 CTCTAGGCACCTGGAGAGCAGGG - Exonic
935664288 2:105496753-105496775 CTGTAGCCACGATGGGTGCAGGG - Intergenic
935817883 2:106864220-106864242 CTGTAGTCTCCAGGGCTGCAGGG - Intronic
936069277 2:109354410-109354432 ATGTGGCCTCCAGGAGAGCAGGG + Intronic
936310187 2:111377233-111377255 CTGTCTCCACCTGCGGAGCAGGG - Intergenic
938084045 2:128386539-128386561 CAGAAGCCAGCAGAGGAGCACGG - Intergenic
938408887 2:131047631-131047653 CAGAAGCCAGAAGGGGAGCATGG + Intergenic
943967391 2:194354279-194354301 CTGGAGCCACCTGGGGCCCAAGG + Intergenic
946366297 2:219251161-219251183 CTGTAGACACCTGGGGGGCTGGG + Exonic
946369374 2:219271306-219271328 CTGTAGACACCTGGGGGGCTGGG - Intronic
946903165 2:224391738-224391760 CTATAGTCACCCGGGAAGCAAGG - Intronic
948554474 2:238797872-238797894 CTGCACCCACCAGGGGAATATGG + Intergenic
949057750 2:241937661-241937683 TTGATGCCAACAGGGGAGCATGG + Intergenic
1172608297 20:36230611-36230633 CTGTTACTACCAGGGGGGCAGGG - Exonic
1175326196 20:58130001-58130023 ATGGAGGCAACAGGGGAGCAGGG - Intergenic
1175805589 20:61826778-61826800 ATGAGGCCACCAGGTGAGCAAGG - Intronic
1175998129 20:62820404-62820426 CAGAAGCCACAAGGGGAGAAAGG - Intronic
1176652583 21:9564179-9564201 CTGGACCCACCAGTGCAGCAGGG - Intergenic
1178693884 21:34776091-34776113 CTGTGGTCACCAGGGGAACCAGG - Intergenic
1179035454 21:37755662-37755684 GTTTAGCCAGCAAGGGAGCATGG + Intronic
1179133549 21:38660473-38660495 CTGTAGCCAGCGTGGGAGCCGGG + Intronic
1179256898 21:39724769-39724791 CTGCAGCCACCAGCTGGGCAGGG + Intergenic
1179598772 21:42461680-42461702 CTGTAGACAACAGGGGTTCAGGG - Intergenic
1179613337 21:42566236-42566258 CTCTCACCACCAGGGGTGCAGGG - Intronic
1180002523 21:45001797-45001819 CAGCAGCCTCCAGGTGAGCAGGG - Intergenic
1181737496 22:24893241-24893263 CTGAAGACACAAAGGGAGCAAGG - Intronic
1182985776 22:34714770-34714792 CTGGAGCCTCGAAGGGAGCATGG + Intergenic
1183191646 22:36325431-36325453 TTGAAGCCATCAGGGGAGCTTGG - Intronic
1184142202 22:42584510-42584532 CTGGAGCCAGTTGGGGAGCACGG - Exonic
1184499356 22:44862443-44862465 CCGGAGGCACCTGGGGAGCACGG + Exonic
1184869946 22:47231570-47231592 CTGGAGACCTCAGGGGAGCAGGG - Intergenic
1184872320 22:47248768-47248790 CTGTAGGCAAAAGGGAAGCAAGG - Intergenic
1184978457 22:48079774-48079796 CCGCAGCCACCAGGAGAGGAGGG + Intergenic
1185155592 22:49191721-49191743 CTTCAGCCGCCAGGGCAGCAGGG - Intergenic
949402991 3:3684687-3684709 CTGTTGCCAGCTGGGCAGCAGGG - Intergenic
952493351 3:33893344-33893366 CTGTAGTCACCAAAAGAGCATGG - Intergenic
953488557 3:43326719-43326741 CTGTACCCACCAGGGTAGATGGG + Intronic
953517946 3:43615275-43615297 CAGTAGCAAACAGGGGAGCTGGG + Intronic
954199205 3:49014249-49014271 CTGCAGCCACAAGGGGGCCAAGG - Exonic
954493495 3:50930598-50930620 CTGGAGCCACCAAGGGAGCCTGG - Intronic
954553896 3:51503558-51503580 GTCTAGCCAACAGGAGAGCAGGG - Intergenic
955748259 3:62161702-62161724 CTGTAGCCACAGGAGGGGCATGG + Intronic
956520870 3:70102763-70102785 CTGTAGTCATCAGGAGAGAATGG + Intergenic
956718385 3:72098156-72098178 CTGAAGGGACAAGGGGAGCAGGG + Intergenic
957079426 3:75623714-75623736 CTCCAGCCACCAGGGGCACAGGG + Intergenic
958436214 3:94098946-94098968 CTGTAAGCCCCATGGGAGCAGGG + Intronic
958854156 3:99364367-99364389 CTATAGACTCCAGGAGAGCAAGG + Intergenic
960544309 3:118894919-118894941 CTGCTGACACCAGTGGAGCAGGG - Intergenic
960864628 3:122186569-122186591 CTGTAAGCTCCAGGAGAGCAGGG - Intronic
963903302 3:150753102-150753124 CTGGTGCCACCATGGCAGCAAGG + Intronic
969290500 4:6236008-6236030 CTGTCACCACCAGAGCAGCAGGG - Intergenic
969566972 4:7984472-7984494 CGGCAGCCACACGGGGAGCAAGG + Intronic
970802354 4:19988704-19988726 CTGTATCCAGCATGGGAGCCTGG - Intergenic
971273323 4:25171917-25171939 CTGGAGCAACAAGGGGAGCCAGG - Intronic
973576860 4:52298313-52298335 CTGTAGCCATAAGCAGAGCAGGG + Intergenic
975666329 4:76738821-76738843 GTGCAGCTCCCAGGGGAGCATGG + Exonic
975825983 4:78320106-78320128 CTGGAGCCTCCCAGGGAGCAGGG - Intronic
976111738 4:81682677-81682699 CTCCAGCCACCTGGGGAGAATGG + Intronic
981080333 4:140633864-140633886 CTGTAGCCCTGAGGGCAGCATGG + Intronic
981322751 4:143411585-143411607 CTGGAGCTACCAAGGCAGCAAGG + Intronic
981525638 4:145704603-145704625 CTGTAGCAATCAAAGGAGCATGG - Intronic
984129081 4:175851066-175851088 CTGTAGCCTCCAGCTGGGCATGG + Intronic
984218417 4:176943336-176943358 CTGCAGGCTCCAGTGGAGCATGG - Intergenic
984974526 4:185218661-185218683 CTGAAGCAAAGAGGGGAGCAAGG + Intronic
985064287 4:186105433-186105455 CTGGGACCACCAGGCGAGCAGGG - Intronic
985626957 5:994067-994089 CTGCAGGCTCCAGGGGAGGAGGG + Intergenic
986771663 5:10979318-10979340 CTGTAGACACCAGGTCACCAGGG - Intronic
987193277 5:15500470-15500492 CTGGAGCCACCGGGGGTGCCAGG + Exonic
987326838 5:16820076-16820098 CTGGGGCCACCTAGGGAGCAGGG + Intronic
988554460 5:32224093-32224115 CAGTAGCCTCCAGGAGAGGATGG - Intergenic
989102243 5:37834487-37834509 CTGAAGCCCCCAGGGGTGCCTGG - Intronic
990814667 5:59769922-59769944 ATGGAGCAACCAGGGGGGCAGGG - Intronic
991202335 5:64008862-64008884 CTGCAGCCACCACGGAAGCTGGG + Intergenic
991923533 5:71681330-71681352 CTGAAGCCACCAAGGGAGTCTGG + Intergenic
992641852 5:78774520-78774542 CTGAATCCACCTGGGTAGCAGGG + Intergenic
997440519 5:133905815-133905837 CTCTAGCCACAAGGGCAGCTGGG - Intergenic
1001162531 5:169333625-169333647 GTGTGGGCTCCAGGGGAGCATGG - Intergenic
1001769626 5:174283476-174283498 CTGGAGCCAGAAGGGGAGAATGG + Intergenic
1002132964 5:177092575-177092597 CTGTGGCCAACAGGGAAGCTGGG - Intronic
1003130572 6:3392071-3392093 CTGTAGGAAGAAGGGGAGCATGG - Intronic
1003421410 6:5961526-5961548 CTGGAGAGACCATGGGAGCAAGG + Intergenic
1003628036 6:7761537-7761559 CTGGAGCCAACAGGGGTGGATGG + Intronic
1006510416 6:34518304-34518326 CTGTGGCCACCTGGAGAGCAGGG - Intronic
1007296541 6:40826480-40826502 CTGAAGCCTCTAGGGGAGGAAGG - Intergenic
1007509410 6:42363825-42363847 CTGGAGTCTCCAGAGGAGCATGG + Intronic
1008286799 6:49662890-49662912 CTGTCACCAGCAGTGGAGCAAGG + Intergenic
1010205949 6:73322771-73322793 TTGCAGACACCAGGGGTGCAGGG - Intergenic
1010862703 6:80933148-80933170 CTGTAGTCACCAAAAGAGCATGG - Intergenic
1012063054 6:94511849-94511871 CTGGCTCCAGCAGGGGAGCAGGG - Intergenic
1017034580 6:150255827-150255849 CTGCAGCCACCCAGGGAGCCAGG + Intergenic
1017650710 6:156578943-156578965 CTACAGCCAGCAGAGGAGCAGGG + Intergenic
1019731809 7:2632928-2632950 CTGTAGCCCCCGGGGGAGGGAGG + Intronic
1021340493 7:19457768-19457790 CTGTAGCCACCACAGCATCAAGG - Intergenic
1022521168 7:31007859-31007881 CTGAAGCCTCCAGGGAGGCAGGG - Intergenic
1022684346 7:32581876-32581898 CTGAAGCCACCTGGGCAGCCTGG - Intronic
1023579016 7:41661698-41661720 CTGGAGCCACCAGAGCTGCAGGG + Intergenic
1026794938 7:73359954-73359976 GTGATGCCACCAGGGGACCAGGG + Intergenic
1034964259 7:155381907-155381929 CTGTAGCCGCCAGGGGAGGCCGG - Intergenic
1036810688 8:11866380-11866402 GCGTTGCCACCTGGGGAGCAAGG + Intronic
1037660742 8:20924531-20924553 CTGTGGCCATCTGGGGACCAGGG - Intergenic
1041944865 8:63429428-63429450 CTCTAGCCACCAAGACAGCATGG + Intergenic
1042401580 8:68354884-68354906 CTGTAGCGTCTAGGGGAGCATGG + Intronic
1042927947 8:73986024-73986046 CTGAAGCCTCCAGGGGAGTTGGG + Intergenic
1048865992 8:138762284-138762306 CTGCAGCCTCCAGCTGAGCAAGG + Intronic
1049172543 8:141170705-141170727 CAGGAGCCACCTGGGGGGCAGGG + Intronic
1049415719 8:142493962-142493984 CTGTTTCCACCAGGGCACCAAGG + Intronic
1049446113 8:142632389-142632411 CTGGGGCCACCAGGGGAGAGGGG - Intergenic
1049571482 8:143372111-143372133 CTGGGGCCAGGAGGGGAGCAGGG + Intronic
1051423837 9:16914951-16914973 CTGTAGGCAGCAGAGAAGCATGG - Intergenic
1051667841 9:19482025-19482047 ATGCAGCCTCCAGGGGAGAAAGG - Intergenic
1052363898 9:27589773-27589795 CTGTAGCCAGGAGGGGCTCATGG + Intergenic
1052443007 9:28521970-28521992 CTGTATCCATCGAGGGAGCATGG + Intronic
1053053201 9:34978094-34978116 CTGAAGCCCCCAGGATAGCATGG + Exonic
1055011337 9:71569319-71569341 TTGGAGCCTTCAGGGGAGCATGG + Intergenic
1056886420 9:90448168-90448190 CTGTAGCTACCAGGTGGCCAAGG - Intergenic
1057847541 9:98537076-98537098 CTGAAGCCACCTGGAGAGCTTGG + Intronic
1057927443 9:99165867-99165889 CTCTTGCCACCAGGTGAGGAAGG + Intergenic
1059438076 9:114288443-114288465 CTGTGTCCACAGGGGGAGCAGGG + Exonic
1059545372 9:115170704-115170726 CTGTAGCCACCAGGGGAGCAGGG - Intronic
1060017414 9:120098715-120098737 AGGGAGCCTCCAGGGGAGCATGG + Intergenic
1062370381 9:136235742-136235764 CTGTAGCCACCAGAGCTCCACGG - Intronic
1062736808 9:138141974-138141996 CTGTGGGGACCAGGGGACCAGGG - Intergenic
1203791228 EBV:152831-152853 ATGAAGCCCCCAGGGGAGCGTGG - Intergenic
1203630313 Un_KI270750v1:67720-67742 CTGGACCCACCAGTGCAGCAGGG - Intergenic
1185451251 X:281476-281498 CTGCAGCCACCTGGGAAGCCTGG + Exonic
1186210499 X:7245458-7245480 CTGTAGACACCATGTGAGCAGGG - Intronic
1186669400 X:11754944-11754966 CTGTAGCCACCTTGGCACCACGG - Intergenic
1187280780 X:17857305-17857327 CTGGAGCCACCGAGGGAGCTGGG - Intronic
1187902156 X:24035289-24035311 CTGGAGCCAGTTGGGGAGCAGGG - Intergenic
1188044767 X:25413305-25413327 CTGTAGCCTCCAGGCAAACAGGG - Intergenic
1190446050 X:50525555-50525577 CTATAAGCTCCAGGGGAGCAAGG - Intergenic
1190928448 X:54928957-54928979 CTGAAGCCACCACTGGAGCTGGG - Exonic
1201225435 Y:11813961-11813983 ATGCAGACACCACGGGAGCAGGG + Intergenic
1201583862 Y:15538992-15539014 CTGTAGACACCATGTGAGCAGGG - Intergenic