ID: 1059549324

View in Genome Browser
Species Human (GRCh38)
Location 9:115212859-115212881
Sequence TGTGGACCAAATTGACAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 94}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059549324_1059549327 -10 Left 1059549324 9:115212859-115212881 CCAGCCTGTCAATTTGGTCCACA 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1059549327 9:115212872-115212894 TTGGTCCACAGAGAGAATGGTGG No data
1059549324_1059549329 7 Left 1059549324 9:115212859-115212881 CCAGCCTGTCAATTTGGTCCACA 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1059549329 9:115212889-115212911 TGGTGGTTTTATGACATTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059549324 Original CRISPR TGTGGACCAAATTGACAGGC TGG (reversed) Intronic
900076693 1:823019-823041 GGTGGACCTGCTTGACAGGCAGG - Intergenic
900724517 1:4207213-4207235 TGTGGTACAGATCGACAGGCAGG + Intergenic
900754981 1:4427687-4427709 TCTGGGCCAAATTCAGAGGCAGG + Intergenic
903021370 1:20397601-20397623 TGTGGACCAGATCCTCAGGCAGG + Intergenic
903129489 1:21269375-21269397 TGTGGACCCAGTTGTCAGGAAGG - Intronic
903568149 1:24284491-24284513 TGTCAACCAAGTTGAGAGGCTGG - Intergenic
906073781 1:43036499-43036521 TGTGGACCATCATGACAGCCTGG - Intergenic
906236191 1:44212627-44212649 TGTCCTTCAAATTGACAGGCTGG + Intergenic
906503692 1:46361301-46361323 TATGGACCAAATTGCTATGCTGG - Intronic
908582867 1:65535630-65535652 TGTGGACCATCGTGCCAGGCTGG + Intronic
910542201 1:88372551-88372573 TGTGCATCAAAGGGACAGGCTGG - Intergenic
911104752 1:94120924-94120946 TGTGGAGCAAATAAACAGGTTGG - Intronic
911681618 1:100723102-100723124 TGTATACCCATTTGACAGGCTGG + Exonic
913721952 1:121605122-121605144 TGTGGAGCATATTGAAAAGCTGG + Intergenic
913741736 1:121852704-121852726 TGTGGAGCATATTGAAAAGCTGG + Intergenic
915655601 1:157357254-157357276 CCTGGACCAAATTGAAAGTCAGG - Intergenic
916900812 1:169220938-169220960 TATGTACTAAATTGACAGGCAGG + Intronic
918507293 1:185270254-185270276 ACTGTACCAAAATGACAGGCTGG + Intronic
921113859 1:212067592-212067614 TCTGAACCAAATTCTCAGGCAGG + Intronic
921353457 1:214261738-214261760 TGTGGACAGGAGTGACAGGCGGG - Intergenic
921481639 1:215670896-215670918 TGTGCACCATTTTTACAGGCAGG + Intronic
922307784 1:224358980-224359002 TGTGGACAAAATCTACAGGAAGG + Intronic
1066017229 10:31260132-31260154 TGAGGAGCATATTGACTGGCTGG - Intergenic
1073875878 10:107920760-107920782 TGGGCACCAATTTGACAGTCTGG - Intergenic
1075517208 10:123118562-123118584 AGTGGCCCAAATAGACAGGTGGG - Intergenic
1078235824 11:9483723-9483745 TGTGAACCAATTTGCCCGGCCGG + Intronic
1089683649 11:120133450-120133472 AGGGGAGCAAAGTGACAGGCAGG - Intronic
1091658597 12:2363917-2363939 TGTGGTCCAAACTTACTGGCCGG + Intronic
1092610044 12:10162859-10162881 TGTGGACTAAAAAGACAGTCTGG + Intronic
1100019637 12:90053444-90053466 TGTGGACTAAATTAACAGACTGG - Intergenic
1110213433 13:73000098-73000120 TGTAGACTAAGCTGACAGGCGGG + Intronic
1112969238 13:105238628-105238650 TGTTTACCAAATAGAAAGGCAGG + Intergenic
1113273312 13:108699685-108699707 TGTGGTACAAATTGTCTGGCGGG - Intronic
1115517538 14:34200771-34200793 TATGGACAAAACTGAGAGGCAGG + Intronic
1118731459 14:68669892-68669914 GGTTGTCCAAACTGACAGGCAGG - Intronic
1119129082 14:72155148-72155170 TGTGACTCAAAGTGACAGGCAGG - Intronic
1126777775 15:52113835-52113857 TTTCAACCCAATTGACAGGCTGG + Intergenic
1129041790 15:72693697-72693719 TGTAGACCAAATAAACAGGATGG + Intronic
1130357841 15:83150996-83151018 AGAGATCCAAATTGACAGGCAGG + Intronic
1130951406 15:88592695-88592717 TGTTGCACAAATTGACATGCTGG - Intergenic
1133503933 16:6391728-6391750 TGTGGACCAGATGGATGGGCAGG + Intronic
1135241175 16:20807896-20807918 TGGGGACCCCATGGACAGGCAGG - Intronic
1135887488 16:26324310-26324332 TGTGGACCAGATTGAGAGCCTGG + Intergenic
1136157431 16:28392635-28392657 TTTGGAGCAAAATGACAGGTTGG - Intronic
1136205656 16:28722649-28722671 TTTGGAGCAAAATGACAGGTTGG + Intronic
1139126902 16:64089103-64089125 TATGGATCTACTTGACAGGCTGG - Intergenic
1139177094 16:64701358-64701380 TGTGGACCCTGTTGCCAGGCTGG + Intergenic
1139516763 16:67456989-67457011 TGTGGAGCAAAGTGGGAGGCTGG - Intronic
1142000776 16:87663000-87663022 TATGGTCCAAAGAGACAGGCTGG - Intronic
1146512764 17:33464333-33464355 TGTGAACCAAATTGGAAAGCTGG + Intronic
1150369896 17:64628301-64628323 TTTGGACCAGATTCAAAGGCTGG + Intronic
1150408490 17:64922520-64922542 TATAGAGCAATTTGACAGGCCGG - Intergenic
1150743342 17:67797226-67797248 TGAGGATCAAATTGGGAGGCAGG + Intergenic
1152611688 17:81318061-81318083 TGTTAAACAAATTGACTGGCTGG - Intronic
1164246765 19:23436913-23436935 TGTGGAACAAATTGAAAGTGGGG + Intergenic
1166610082 19:44183837-44183859 TGTGGATGACATTTACAGGCAGG - Intergenic
1167937561 19:52920259-52920281 TGGGGAAAAAATTGAGAGGCCGG + Intergenic
926292712 2:11543417-11543439 TGAGGACTAAATTAACATGCAGG - Intronic
928709186 2:33985735-33985757 TGTGGACCCAAGTGAGAGACAGG - Intergenic
940416087 2:153421599-153421621 TTTGGACCAAATTCGCAAGCTGG - Intergenic
947144016 2:227047513-227047535 GGTGGACCAAAGTGACTGGCAGG + Exonic
947552390 2:231055773-231055795 TGTGGCTCAGATTGAAAGGCAGG - Intergenic
1169966190 20:11220273-11220295 TGTGCACCTATTGGACAGGCAGG - Intergenic
1171449536 20:25225974-25225996 TGGGGAGGAAACTGACAGGCTGG - Exonic
1174691977 20:52515670-52515692 TGGAGACCAAATGAACAGGCAGG - Intergenic
1181515984 22:23413594-23413616 TGTGGACCACATTGCCAAGGCGG + Intergenic
1181633663 22:24164417-24164439 CGTGGACGAGATTGACCGGCCGG + Exonic
1181841399 22:25665191-25665213 TGTGGAGCACAGTGATAGGCGGG - Intronic
1183089710 22:35513487-35513509 TGTGTACTATAGTGACAGGCAGG + Intergenic
952030994 3:29142626-29142648 TGTGGAGAAAGTTGCCAGGCGGG + Intergenic
952184222 3:30951366-30951388 TTTTGGCCAAATTGACAGGGGGG + Intergenic
953759384 3:45674714-45674736 TGCGGGCCACATTGTCAGGCAGG + Intronic
959200695 3:103242896-103242918 TCTGTACCAACTTGACAGGATGG - Intergenic
968181920 3:196601727-196601749 TGAGCACCACACTGACAGGCCGG + Intergenic
968410230 4:384157-384179 TTTGGACCTAATTGCCAGGCTGG - Intronic
969298269 4:6282068-6282090 AGGGCACCAAACTGACAGGCAGG - Intronic
973646367 4:52954933-52954955 TGTGGATCAAAAGGACAGGGAGG - Intronic
980111014 4:128636820-128636842 TGTTTGCCAAATTCACAGGCTGG - Intergenic
982247367 4:153366610-153366632 TGTGGAACAACTTGAGAGTCAGG - Intronic
984658525 4:182346852-182346874 GTTGGACCGACTTGACAGGCAGG - Exonic
986653798 5:9990674-9990696 TGTGGATGAAATAGACATGCTGG - Intergenic
987035873 5:14017636-14017658 TGTGGACCACAATGACCAGCAGG - Intergenic
988137128 5:27188214-27188236 TGTGGGGCAGGTTGACAGGCTGG + Intergenic
1006276235 6:33007407-33007429 TGCGGAACAAATGGTCAGGCTGG + Exonic
1006640727 6:35488334-35488356 TGTGGTCCAAATTAATAGCCTGG - Intronic
1007839935 6:44707776-44707798 TGTGGAGCAACTGGACAGGATGG + Intergenic
1026995906 7:74616356-74616378 TGGGGACCAAAGTGACACTCTGG + Intergenic
1028220135 7:88187827-88187849 TATGGATCAAATTAAAAGGCAGG - Intronic
1028546005 7:92000695-92000717 TGTGGAAAAAATTGAGGGGCAGG + Intronic
1029446189 7:100614041-100614063 TGTGGACCTATCCGACAGGCAGG - Intronic
1029911520 7:104155393-104155415 TGTGTACCATATTGACAAGTTGG - Intronic
1034910115 7:154989468-154989490 TGAGCACCAAAATGACAGCCTGG + Intronic
1041507812 8:58620757-58620779 TGTGGACCATATGAAGAGGCTGG + Intronic
1044933269 8:97270462-97270484 TGAGGACCAGGTTGACAGGATGG + Intergenic
1049326139 8:142022467-142022489 TGTGGACAAAAATGGGAGGCTGG + Intergenic
1049991410 9:995122-995144 TGTTGACCAACTTAACAGCCTGG - Intergenic
1051482786 9:17578151-17578173 TGTGGACCAAAGTGATAAGAAGG - Intergenic
1052817761 9:33114686-33114708 TGAGGACCAAAATGAAAGCCTGG + Intronic
1059549324 9:115212859-115212881 TGTGGACCAAATTGACAGGCTGG - Intronic
1061454713 9:130689021-130689043 AGTGAACCAAATGGACAGTCTGG + Intergenic
1193586992 X:83335686-83335708 TTTGGAGCAAATTAACAGGCAGG - Intergenic