ID: 1059560842

View in Genome Browser
Species Human (GRCh38)
Location 9:115333323-115333345
Sequence GCCCCTACTCTCCTGGTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 151}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059560842_1059560845 -7 Left 1059560842 9:115333323-115333345 CCAGTGACCAGGAGAGTAGGGGC 0: 1
1: 0
2: 1
3: 14
4: 151
Right 1059560845 9:115333339-115333361 TAGGGGCCACTGAGGAAAACAGG No data
1059560842_1059560849 15 Left 1059560842 9:115333323-115333345 CCAGTGACCAGGAGAGTAGGGGC 0: 1
1: 0
2: 1
3: 14
4: 151
Right 1059560849 9:115333361-115333383 GCTAAATTAATTGAATGATGGGG No data
1059560842_1059560848 14 Left 1059560842 9:115333323-115333345 CCAGTGACCAGGAGAGTAGGGGC 0: 1
1: 0
2: 1
3: 14
4: 151
Right 1059560848 9:115333360-115333382 GGCTAAATTAATTGAATGATGGG No data
1059560842_1059560850 21 Left 1059560842 9:115333323-115333345 CCAGTGACCAGGAGAGTAGGGGC 0: 1
1: 0
2: 1
3: 14
4: 151
Right 1059560850 9:115333367-115333389 TTAATTGAATGATGGGGAGAAGG No data
1059560842_1059560852 30 Left 1059560842 9:115333323-115333345 CCAGTGACCAGGAGAGTAGGGGC 0: 1
1: 0
2: 1
3: 14
4: 151
Right 1059560852 9:115333376-115333398 TGATGGGGAGAAGGATGAGGAGG No data
1059560842_1059560847 13 Left 1059560842 9:115333323-115333345 CCAGTGACCAGGAGAGTAGGGGC 0: 1
1: 0
2: 1
3: 14
4: 151
Right 1059560847 9:115333359-115333381 AGGCTAAATTAATTGAATGATGG No data
1059560842_1059560851 27 Left 1059560842 9:115333323-115333345 CCAGTGACCAGGAGAGTAGGGGC 0: 1
1: 0
2: 1
3: 14
4: 151
Right 1059560851 9:115333373-115333395 GAATGATGGGGAGAAGGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059560842 Original CRISPR GCCCCTACTCTCCTGGTCAC TGG (reversed) Intronic
901800248 1:11704315-11704337 CCCCCTGCTCTCCTTGTGACTGG - Intronic
902468474 1:16631986-16632008 GTCCCAACTCTCCTGCTTACTGG + Intergenic
904287366 1:29461131-29461153 GCCCCCAGCCTCCTGGTGACTGG - Intergenic
904328800 1:29744863-29744885 GCCCCCAACCTCCTGGTGACTGG - Intergenic
904370626 1:30045500-30045522 GCCCCCAGTCTTCTGGTGACTGG - Intergenic
904409727 1:30318252-30318274 CCCCCCACTCTCCTGCTCCCAGG + Intergenic
904417670 1:30373115-30373137 GCCCCCATCCTCCTGGTGACTGG + Intergenic
904435137 1:30490129-30490151 GCCCCTACTCTTCAGGTAACTGG - Intergenic
905025005 1:34843896-34843918 GCCCCTGCTTTCCTGGTAATTGG - Intronic
907276404 1:53319287-53319309 CCCCATCCTCCCCTGGTCACTGG - Intronic
909124962 1:71656284-71656306 GCCCCTATTCTCCTTCTAACAGG + Intronic
910892250 1:92030127-92030149 GTCCCTGCTCTTCTGGTCCCTGG + Exonic
912737994 1:112167253-112167275 ATGCATACTCTCCTGGTCACAGG - Intergenic
913061870 1:115216202-115216224 GCCCCTGCTCTCCAGGCCGCAGG - Intergenic
914981240 1:152416095-152416117 GCCCCTACTCTGCTTTTCCCTGG - Intergenic
918240085 1:182613260-182613282 CCCCCTACCTTCCAGGTCACAGG + Intergenic
921008142 1:211114137-211114159 GTCCCTGCTCTGCTGGTCACTGG - Intronic
923626848 1:235621014-235621036 GCTCCTTCTCACCTAGTCACTGG + Intronic
1064242093 10:13640108-13640130 GACACCACTCTCCTGGTAACTGG - Intronic
1064372174 10:14762164-14762186 GCTCCTGCTCTCATGCTCACAGG + Intronic
1067095171 10:43295044-43295066 GCCGCTCCTCTCCTCCTCACAGG + Intergenic
1073084859 10:100881831-100881853 TTCCTTCCTCTCCTGGTCACGGG - Intergenic
1074768580 10:116718481-116718503 GCCTCTGCCCTCCTGGGCACTGG - Intronic
1076824432 10:132959986-132960008 GCCCCGTCTCTCCTGGTCTGAGG - Intergenic
1081573335 11:44304550-44304572 CCCCCTCCTCTCCTGGCCTCAGG + Intronic
1081603512 11:44511987-44512009 GCCCTTGACCTCCTGGTCACTGG - Intergenic
1083801033 11:65046399-65046421 GCCTCTCCTGTCCTGGTCTCAGG + Intronic
1084474031 11:69378609-69378631 GCCCCTGCTCTCTTGAACACTGG + Intergenic
1084883897 11:72190872-72190894 GCCCCTCCTCTCCTCTTGACAGG - Intronic
1085017619 11:73185683-73185705 GCCCCTCCACTCCGGGTCCCAGG + Intergenic
1085054054 11:73393942-73393964 AACCCTCCTCTCCTGGGCACTGG - Intronic
1091320472 11:134645912-134645934 GCCCCTCAACTCCTGGCCACAGG + Intergenic
1096531550 12:52245723-52245745 GCCCCTCCTCTGCAGGGCACTGG + Intronic
1096917730 12:55051332-55051354 GACCCAGCTCTCCTGCTCACAGG - Intergenic
1097970328 12:65626562-65626584 GTCCCTATACTCCTGGTCCCAGG + Intergenic
1100230869 12:92605679-92605701 TCCCCTGCTCTCCTGGTCTGTGG + Intergenic
1101561546 12:105862338-105862360 GCCCCAGCTCTCCTGCTCCCTGG + Intergenic
1101866648 12:108525157-108525179 GCCCGTATGCTGCTGGTCACAGG + Intronic
1101880489 12:108622712-108622734 TCCCCGCTTCTCCTGGTCACTGG - Intronic
1102171825 12:110848197-110848219 GCACTCACTCTCCTGGCCACAGG - Intronic
1104763606 12:131312901-131312923 GCCCCTGCTCTCCAGGCCTCTGG - Intergenic
1104815894 12:131645176-131645198 GCCCCTGCTCTCCAGGCCTCTGG + Intergenic
1111832317 13:93344471-93344493 GCCCCTATTTTCCAGGTCTCTGG + Intronic
1112075008 13:95903375-95903397 AAACCTACTATCCTGGTCACTGG + Intronic
1113280154 13:108779732-108779754 GCCCCAGGTCTCCTTGTCACTGG - Intronic
1113707565 13:112444417-112444439 GCCCCCACTCTCATGGCCTCTGG - Intergenic
1113740055 13:112705465-112705487 GCCCCAGCTCTCCTGGAGACTGG + Intronic
1120827883 14:88971540-88971562 GTCCCTCCACCCCTGGTCACGGG - Intergenic
1121220552 14:92281687-92281709 GTCCCTACTGTGGTGGTCACTGG + Intergenic
1122268297 14:100556897-100556919 GCCCCCTCTCTGCAGGTCACAGG + Intronic
1122403088 14:101479014-101479036 GTCCCTCCTGTCCTGGCCACAGG + Intergenic
1124233518 15:27967212-27967234 GCCCCTTCCCTCCTGGGCTCTGG - Intronic
1127834105 15:62776139-62776161 GCCCCTACTCTGCTTGACACAGG + Intronic
1128835636 15:70807200-70807222 GCCTCTTCTCTACAGGTCACGGG + Intergenic
1129673063 15:77617610-77617632 GCCCCTGCTTTCATGGCCACAGG + Intronic
1131159135 15:90092999-90093021 GCCCCCACCCTCTTGGCCACTGG - Intronic
1132090868 15:98947096-98947118 GCCCCTTCTCCCCTGGGCCCAGG + Intronic
1132937725 16:2490007-2490029 GCACCTACTCTGCTGGTGTCTGG + Intronic
1133297472 16:4761984-4762006 ACTCCTACTCTGCTGGGCACAGG - Intronic
1133981036 16:10633481-10633503 GCCCCCACTCTCCTGCACCCAGG + Intronic
1136541588 16:30930360-30930382 GCCCCTACTCAGCTGGCCCCTGG + Exonic
1139558869 16:67729276-67729298 GCACCTGGTCTCCTGGTTACTGG + Exonic
1140061708 16:71576121-71576143 TCCTCTACTCTCATGTTCACAGG - Intronic
1140133159 16:72182143-72182165 AGACCTATTCTCCTGGTCACCGG + Intergenic
1140506745 16:75478382-75478404 GCCCCTCCTCCTCTGGGCACAGG - Exonic
1141657097 16:85422160-85422182 CCCCCTCCTCCCCTGGTCCCTGG + Intergenic
1142360713 16:89625279-89625301 GACCCTATTCTCCTGCTCCCAGG + Intronic
1146129659 17:30260482-30260504 GCACATACTCTCCAGTTCACTGG - Intronic
1147320330 17:39642147-39642169 GCCTCTACTCTGCTGATCATTGG - Intronic
1152880109 17:82809588-82809610 GCCTCTTCTCTCCTGGTCTCTGG + Intronic
1160790923 19:923394-923416 CCCCCAACCCTGCTGGTCACTGG - Intergenic
1160964488 19:1740529-1740551 GAACCTTCTCTCCTGGTCCCTGG - Intergenic
1163387568 19:17009149-17009171 GCCTCTTCTATCCTGGTCCCTGG - Intronic
1163729215 19:18940130-18940152 GCAGCTGCTGTCCTGGTCACAGG + Intronic
1163817851 19:19477803-19477825 GCCCCTAGACTGCTGGTCTCCGG - Intronic
1164136125 19:22417955-22417977 GGCTCTACTCTCCTGTACACAGG - Intronic
1164841631 19:31397468-31397490 GCCCCTGCTCTCCTTGTCCATGG + Intergenic
1165586120 19:36917108-36917130 GTCCTTACTCTCCTGTTCACAGG + Intronic
1165710853 19:38009806-38009828 GACCCTGTCCTCCTGGTCACTGG - Intronic
1166048199 19:40242073-40242095 GCCCCCACTCTCCCTGTCCCTGG - Intronic
1166561063 19:43732743-43732765 GCCCCTCCTCTCCAGATCCCAGG - Intronic
1166704486 19:44901094-44901116 GCACCCACTCACCTGGTCACTGG - Exonic
1167425841 19:49429187-49429209 GCCCCTCCTCTCCCGGACCCAGG - Intergenic
1167425856 19:49429223-49429245 GCCCCTCCTCTCCCGGACCCAGG - Intergenic
932559485 2:72854910-72854932 GCCCCTACACCCCTTGTCTCAGG + Intergenic
933531500 2:83517655-83517677 TCCCCTACTTTCCTGATAACCGG + Intergenic
933934199 2:87187492-87187514 TCCCCTCCTCTCCTAGTCAGGGG - Intergenic
935384433 2:102485975-102485997 ACCCCCACTGTCCTGGACACAGG + Intronic
936358943 2:111778403-111778425 TCCCCTCCTCTCCTAGTCAGGGG + Intronic
947257226 2:228180590-228180612 GCCCCACCTCTCCTGGGCAGCGG - Intronic
947904703 2:233752239-233752261 GACCCTACTGTGATGGTCACAGG + Intronic
1175154053 20:56957641-56957663 GCCCCTACTCTCCCCTGCACGGG - Intergenic
1176364667 21:6025690-6025712 GCCCCTCTTCTCCAGTTCACTGG + Intergenic
1179758851 21:43512855-43512877 GCCCCTCTTCTCCAGTTCACTGG - Intergenic
1179787568 21:43738358-43738380 TCTCCTACTGTCCTGGGCACGGG - Intronic
1181437344 22:22918500-22918522 GCCCCTGCTCTGCTGGTCTTTGG - Intergenic
1184729392 22:46364555-46364577 GCCCCCGCTCTCCTGGTCCGGGG + Exonic
1185143401 22:49116617-49116639 GCCACTCCTCTCATGGTCGCTGG + Intergenic
1185322826 22:50209739-50209761 GCCCCTATTCTCAAGGTTACCGG + Intronic
1185360389 22:50403410-50403432 GGCCCTCCTCTCCTGCTCTCTGG + Intronic
950553936 3:13684110-13684132 GGCCCTACACTCTCGGTCACAGG - Intergenic
952494272 3:33902262-33902284 TCTCCTACTCTCCTGGTAATTGG - Intergenic
952761210 3:36915838-36915860 ACACCTACTGTCCTCGTCACTGG - Intronic
954154618 3:48678560-48678582 GCACCTTGTCTCCTGGTGACAGG + Exonic
954304729 3:49719606-49719628 GCCCCTACTCTCCGGTTCCCAGG + Exonic
956715778 3:72078655-72078677 GCCCCTGCTCGCCTGGTTACTGG + Intergenic
960996631 3:123344582-123344604 GCCCCTACTCTGCTGTTTCCTGG - Intronic
961222808 3:125213043-125213065 GTCCCTAGTCCCCTGGTCCCGGG - Intergenic
965611242 3:170546247-170546269 ACTCCTACTTTCCAGGTCACTGG - Intronic
966599138 3:181757859-181757881 GCCCTTGCTCCTCTGGTCACTGG - Intergenic
966835153 3:184044056-184044078 GCTCCCACTCTCCTGCTCCCAGG + Intergenic
966922128 3:184619363-184619385 GTGCATATTCTCCTGGTCACAGG - Intronic
968916665 4:3499731-3499753 CCCCCTCCTCTCCTGCACACAGG - Intronic
968952897 4:3703712-3703734 GGCCCTCCTCTCCAGGTCTCAGG - Intergenic
969941955 4:10741392-10741414 GCCCAACCTCTCCTGGTCTCGGG + Intergenic
970001260 4:11368403-11368425 GTCCCTACTCTCATGGAGACAGG + Intergenic
974891850 4:67893005-67893027 GCCTCTCCTCTCCTGGTCACCGG + Intergenic
975493254 4:75011537-75011559 GCCAGTACTCTCCTGGACATGGG - Intronic
978775565 4:112503067-112503089 GCTCCTACTTTCCTGCTCAATGG + Intergenic
979721670 4:123906858-123906880 GCCCCTACTTTCCTGGAAACTGG + Intergenic
983524020 4:168741943-168741965 TCCCCTTTTGTCCTGGTCACAGG - Intronic
984711498 4:182889264-182889286 GACCCTGGTCTCCTGGTGACTGG - Intergenic
988841541 5:35088191-35088213 TCACCTACCCTCCTGCTCACAGG + Intronic
991613207 5:68469430-68469452 ACCCCTGCTCCCTTGGTCACTGG - Intergenic
999196484 5:149784899-149784921 GGTCCTAATCTCCTGGGCACTGG + Intronic
999295625 5:150457982-150458004 GCCCCTCCTCCCCTGGACCCTGG - Intergenic
999524933 5:152394481-152394503 CCCCCACCTCTCCTGGTCACCGG - Intronic
999975850 5:156911242-156911264 GGCACTTCTCTCCTGGTCACAGG - Intergenic
1002100753 5:176856389-176856411 GCCCCTTCACTCCTGGTCTGTGG - Intronic
1002368472 5:178730699-178730721 GCCCCGCCCCTCCTGGTCCCCGG - Exonic
1006084861 6:31588496-31588518 GCACCTTCTGTCCTGGTCCCAGG + Exonic
1014215127 6:118745720-118745742 TCCCTTCTTCTCCTGGTCACGGG - Intergenic
1017245889 6:152223868-152223890 GCCCCCACTCTCCTGTGCACCGG - Intronic
1018939984 6:168302668-168302690 TCCCCTCCTCTCCTGAGCACTGG - Intronic
1018940746 6:168307835-168307857 CCACCTGCTCTCCTGGCCACGGG + Exonic
1019442293 7:1053437-1053459 TTCCCACCTCTCCTGGTCACAGG - Intronic
1025185909 7:56858279-56858301 GCCCCTAATCCCTGGGTCACAGG - Intergenic
1025686017 7:63718662-63718684 GCCCCTAATCCCTGGGTCACAGG + Intergenic
1025973411 7:66349726-66349748 GCCCCTACTTTCCAGGCCCCAGG - Intronic
1026043044 7:66884928-66884950 GCCCCTAATCCCTGGGTCACAGG + Intergenic
1026249648 7:68658293-68658315 CCCCCAACTCTCCTAGTCCCTGG - Intergenic
1027205361 7:76093595-76093617 GCCCCTAATCCCTGGGTCACAGG - Intergenic
1030522894 7:110620381-110620403 GCCCCCACTCCCTTGTTCACTGG + Intergenic
1031122218 7:117734870-117734892 ACCCCTGCTCTCCTGGCAACAGG + Intronic
1032780042 7:135158159-135158181 ACCCCTGCCCTCCTGGTCACAGG - Intronic
1033840409 7:145366716-145366738 TCCCCTACCCTCCAGATCACAGG + Intergenic
1035574869 8:697883-697905 GTCCCTACACTCCTCGTCTCAGG - Intronic
1035744860 8:1954601-1954623 GCCCCTTCTGACCTGGGCACAGG - Intronic
1036208563 8:6823686-6823708 GTCCTCACTCTCCTGGGCACTGG - Exonic
1037974298 8:23199190-23199212 GCCTCGGCTCTCCTGGTCAAAGG - Intronic
1038263641 8:26019700-26019722 GCTCTTTCTCTCCTGGTCTCTGG + Intronic
1041784486 8:61616369-61616391 GCCCCAAATCTGCTGCTCACAGG - Intronic
1042242745 8:66681076-66681098 GCCCCAACTCCCCTGGGCTCAGG - Exonic
1043745227 8:83866940-83866962 GCCTCTCCTCTTCTGGCCACTGG + Intergenic
1044379000 8:91510943-91510965 GCCCCTACTCTCCAGCTCAGTGG - Intergenic
1044581351 8:93829464-93829486 GCACCTCCACTCCTGCTCACTGG + Intergenic
1045464539 8:102457620-102457642 GCCCATCCTCAACTGGTCACCGG + Intergenic
1047536990 8:125729052-125729074 GCACCAACACTCCTGGACACAGG + Intergenic
1049215715 8:141407054-141407076 TCCCCAACTCCCCTGGCCACTGG + Intronic
1049339661 8:142105380-142105402 GCCCCTGCTTCCCTGGACACAGG + Intergenic
1049340697 8:142111027-142111049 GCCCCTGATCTGCTGGTCAGAGG - Intergenic
1057298905 9:93865325-93865347 GCCCCACCTCTCCAGGCCACAGG + Intergenic
1059560842 9:115333323-115333345 GCCCCTACTCTCCTGGTCACTGG - Intronic
1187979981 X:24746222-24746244 GAACCTACTCTTGTGGTCACAGG - Intronic
1190725334 X:53186617-53186639 TCCCTTAGTCACCTGGTCACAGG - Intergenic
1195095673 X:101498951-101498973 GCACCTCCTATCCTGGCCACTGG + Intronic
1197918414 X:131561303-131561325 GCCCCGACTGTCCTGTGCACTGG - Intergenic