ID: 1059561472

View in Genome Browser
Species Human (GRCh38)
Location 9:115338830-115338852
Sequence AAGGAGAAGGGAAATGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1455
Summary {0: 1, 1: 0, 2: 10, 3: 134, 4: 1310}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059561472 Original CRISPR AAGGAGAAGGGAAATGTGGA AGG (reversed) Intronic
900125773 1:1068440-1068462 GAGGAGGAAGGAAATGGGGAGGG - Intergenic
900390965 1:2433761-2433783 AAGGAGCGGGGAGAGGTGGATGG - Intronic
900466426 1:2827750-2827772 TGGGAGAAGGGAAAGATGGAAGG + Intergenic
901157807 1:7152298-7152320 AAGGAGAACAGAAACGTGGAAGG - Intronic
901178544 1:7322982-7323004 AAGGGGAAGGGAAAAGGGAAGGG - Intronic
901329345 1:8393035-8393057 TAGGAGAAGGAGAATGTGGTGGG + Intronic
901333441 1:8428153-8428175 AAGGAGGAAGGAAATATAGAAGG + Intronic
901395906 1:8981409-8981431 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
901659875 1:10792353-10792375 AAAGTAAATGGAAATGTGGAGGG + Intronic
902109267 1:14064614-14064636 AAGGAGGCGGGAAAGCTGGATGG + Intergenic
902896718 1:19484954-19484976 ATGGAGAAGGCAAAGGGGGAGGG + Intronic
903793183 1:25908324-25908346 AGGGAGAAAGAAAATGTGGGGGG - Intergenic
903796604 1:25933656-25933678 AAGGAGAGGAGATATGTGGGAGG + Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904319951 1:29690083-29690105 GAGGAGAAGGAAAGTGAGGAAGG + Intergenic
904352394 1:29917280-29917302 AAGGGGAAGGGAAAAGGAGAAGG - Intergenic
904352430 1:29917378-29917400 AAGGAGAAGGGAAAGGGAGAAGG - Intergenic
904807272 1:33140861-33140883 AAGGAGAAGGGGAGAGAGGAGGG - Intergenic
904989417 1:34579611-34579633 TAGGGGTAGGGAAATGTGGAGGG - Intergenic
905108675 1:35578672-35578694 AAGGAGGAGGGAGCTGGGGAGGG + Intronic
905207771 1:36352738-36352760 GAGGGCAAGGGACATGTGGAGGG - Intronic
905217868 1:36422372-36422394 AGGAAGAAGTGAAATGTGAATGG - Intronic
905218320 1:36426138-36426160 AAGGAGAAAGAAAATTTAGAGGG + Intronic
905256465 1:36688548-36688570 AAGGGGAAGGGAAATGGGAAGGG + Intergenic
905256486 1:36688602-36688624 AAGGGGAAGGGAAATGGGAAGGG + Intergenic
905256507 1:36688656-36688678 AAGGGGAAGGGAAATGGGAAGGG + Intergenic
905868268 1:41388052-41388074 AGTGAGAAATGAAATGTGGATGG + Intergenic
906005665 1:42467547-42467569 AAGGAGGAGGGAAAGATGAATGG + Intronic
906515100 1:46434200-46434222 TAAGAGAAGGGGTATGTGGATGG - Intergenic
906575577 1:46886423-46886445 AAAGGGAGGGGAAGTGTGGAGGG + Intergenic
906596399 1:47081473-47081495 AAAGGGAGGGGAAGTGTGGAGGG - Intronic
906680274 1:47721531-47721553 GTGGAGATGGGAAATGTGGATGG - Intergenic
906714258 1:47955291-47955313 AAGGAGAAAGGGACTGGGGAAGG - Intronic
906904362 1:49873390-49873412 AAAGAGGAGAGAAATGTGAAAGG + Intronic
907258504 1:53197895-53197917 GAGGAGAAGAGAAATTTGGGTGG - Intronic
907303752 1:53502862-53502884 AAGGAGAGAGGAGATGGGGAGGG + Intergenic
907327968 1:53653171-53653193 AAGGAGAAAGAAAAAGTGGCTGG + Intronic
907832421 1:58077721-58077743 AAGGAGAAAGGAAAGATTGACGG + Intronic
907835734 1:58106865-58106887 AAGGAGAAAGGGAAGGAGGAAGG - Intronic
908054152 1:60264987-60265009 TAGGGGAAGGGAAATGTGTGTGG + Intergenic
908397532 1:63740157-63740179 AAAGGGAAGGGAAGAGTGGAAGG - Intergenic
908475590 1:64484427-64484449 AAGCAGAAGGGTGATGTGAAGGG + Intronic
909503221 1:76358598-76358620 GTGGAGGAGGCAAATGTGGATGG - Intronic
909506095 1:76391582-76391604 AAGGGGAAGGGGAAGGTGAAAGG - Intronic
909681038 1:78292546-78292568 GAGGAGAAGGGACATCTGGGTGG + Intergenic
910163294 1:84297551-84297573 AAGGAGAAGGAAAAGGCAGATGG - Intergenic
910239779 1:85074072-85074094 AAGGGGTAGGGAGGTGTGGAGGG - Intronic
910429833 1:87149580-87149602 GAGGAGAAGGGAAGAGTGAAAGG - Intronic
910601753 1:89040172-89040194 AAGGGGAAGGGAAAGGGGAAGGG - Intergenic
910701757 1:90082869-90082891 TGGGAGAAGGGAAATGGAGATGG - Intergenic
911123504 1:94319194-94319216 AAAGAGAAAGAAACTGTGGAGGG - Intergenic
911275130 1:95850783-95850805 CAGGAGAAGAGAATTGTGCAGGG - Intergenic
911620893 1:100065618-100065640 AAGGGAAAGGGAAAAGGGGAGGG - Intronic
911620905 1:100065670-100065692 AAGGAAAAGGGGAAAGGGGAAGG - Intronic
911620921 1:100065732-100065754 AAGGGGAAGAGAAAAGGGGAAGG - Intronic
911807200 1:102224936-102224958 TAGAAGATGGTAAATGTGGAGGG + Intergenic
912509522 1:110179505-110179527 AAGGGGAAGGGAAAGGAAGAAGG - Intronic
912661052 1:111530921-111530943 AAGGAGAGGAGAAATAGGGATGG - Intronic
912672143 1:111640145-111640167 AAGAAGTAGGCAAAGGTGGAGGG - Intronic
912747672 1:112258893-112258915 AAGCAGATGGGAAAGGTGGGAGG + Intergenic
912798386 1:112706548-112706570 GAGGATAAGGGAGATGGGGAAGG - Intronic
912913742 1:113790170-113790192 ATGGAGAAGGGAAAGGTTGGAGG + Intronic
913305403 1:117425109-117425131 GAGGAGAAGGGAAAGGGGGAAGG + Intronic
913368278 1:118067451-118067473 ATGGAGAAGGGAAAGAGGGAGGG - Intronic
913705174 1:121413843-121413865 AAGGAGAAGAGGACTGTAGAAGG + Intergenic
914925509 1:151882999-151883021 AAGGTGAAGGGAAAGGGGAAGGG + Intronic
915099940 1:153491851-153491873 AAGGAGAGGGGACTGGTGGATGG - Intergenic
915161291 1:153922609-153922631 TGGGGGAAGGGAAAGGTGGAGGG - Intronic
915310119 1:155002382-155002404 AAGAAGGAGGGAAAGGAGGAGGG + Intergenic
915357771 1:155266453-155266475 AGGGAGAAAGGAAAAGGGGAGGG + Intronic
915393123 1:155562313-155562335 GAGGAGAAGGGAAAGGTGGAAGG + Exonic
915409278 1:155688219-155688241 GAGGAGAAGGGAAAGGTGGAGGG + Exonic
915445228 1:155970739-155970761 AAAGAAAGGGGAAGTGTGGAGGG + Intronic
915713465 1:157922840-157922862 AAGGAGAAGATAACTGTGAATGG + Intergenic
915724922 1:158010707-158010729 AGGGAGGAGGGAAGGGTGGAGGG - Intronic
916160627 1:161909300-161909322 AAGGAGAAAGGGAAGGAGGAGGG + Intronic
916242913 1:162657796-162657818 GAGGAGAAGGGAAAAGAGGAAGG - Intronic
916629197 1:166593590-166593612 AAGGAGATGGGAGCTGTGGATGG - Intergenic
917253420 1:173088077-173088099 AAGAAGAAGGGATGTGGGGAGGG + Intergenic
917497382 1:175553177-175553199 AATGAGATGGGAAAAGTGGTGGG + Intronic
917846385 1:179024038-179024060 ATGGAGAAGGGAAAACTGGGGGG + Intergenic
918029632 1:180792638-180792660 GAAGAGAAGGGAATTGTGAAAGG + Intronic
918256715 1:182755106-182755128 AAGGAACAGGAAAAAGTGGATGG - Intergenic
918469966 1:184861726-184861748 AAGGAGAAGGGGAGGGAGGAAGG + Intronic
918540603 1:185627833-185627855 AAGGAAAATGGGAATGGGGATGG + Intergenic
918646508 1:186912036-186912058 GAGGAGAACAGAAAGGTGGAAGG - Intronic
918814967 1:189170335-189170357 TAGGAGAAAGGAGATGTGGTGGG - Intergenic
918833982 1:189435533-189435555 AAGGGGAAGGGGAAGGAGGAAGG + Intergenic
918988856 1:191671152-191671174 AAGTAGAAGTGAAATGAGGTTGG + Intergenic
919016770 1:192048516-192048538 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
919112955 1:193242419-193242441 AAGGAGAAGGGAAGCCAGGATGG - Intronic
919491021 1:198204925-198204947 AAGAAGAAGGAAAATTGGGAGGG - Intronic
919753893 1:201054604-201054626 GAGGAGGAGGGACATGTGGGAGG + Intronic
920189222 1:204181775-204181797 AAGGAGAAGAGAAAAGAGGAAGG - Intergenic
920255059 1:204649045-204649067 CAGGTGAAGGGATTTGTGGAAGG + Intronic
920297341 1:204967118-204967140 CAGGACAAGGGAAAGGTGGAGGG - Intronic
920330237 1:205202089-205202111 AAGGGGAAGGGAGAGGGGGAAGG + Intronic
920549323 1:206845447-206845469 AAAGAGAAAGGAAAAGTAGACGG - Intergenic
920861750 1:209714569-209714591 AAACAGAAAGGAAATATGGAGGG - Intronic
920881664 1:209886567-209886589 AAAGAGAAGGGAATAGGGGAGGG + Intergenic
920905846 1:210166640-210166662 AAGGAGAAGGGAAAGAAGGGAGG + Intronic
922434144 1:225586309-225586331 AAGGAAAAGGGAAAAGTAGAGGG + Intronic
922465068 1:225841007-225841029 AAGGAGAGGGGATGTGGGGAGGG - Intronic
922597420 1:226824582-226824604 CAGGAGATGAGGAATGTGGATGG - Intergenic
922722749 1:227906876-227906898 AAGCAGAAGGGAAAGGGAGAGGG - Intergenic
922905005 1:229167638-229167660 AAAGAGAAGGGAGAAGTGGGAGG + Intergenic
923072431 1:230577877-230577899 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
923119794 1:230979136-230979158 CAGGGGAAGGGGAACGTGGATGG + Exonic
923127761 1:231047317-231047339 AAAGAGGAGGGAAAGGAGGAAGG - Intergenic
923210483 1:231799824-231799846 AAAGAGAAGGGAAAGAGGGAGGG - Intronic
923230521 1:231982336-231982358 AAGGAGAAAGGTAAGGAGGAAGG - Intronic
923235776 1:232031428-232031450 AAGGAGAAGGGAAAAGGGAAAGG + Intronic
923235782 1:232031447-232031469 AAGGAGAAGGGAAGGGAGAAGGG + Intronic
923474185 1:234317380-234317402 GAGGAGAAGGGAAGTGAGGGGGG - Intronic
923589043 1:235302215-235302237 AAGGGGAAGGGAAAGGGGAAGGG + Intronic
923640263 1:235750911-235750933 AAATAGTAGGGAAATGTAGAGGG - Intronic
923818107 1:237403054-237403076 AAGGAGAGAGGAAAGATGGATGG + Intronic
923986122 1:239384631-239384653 ATGGACAAGGTAAATGTAGATGG - Intergenic
924190441 1:241546143-241546165 CAGGAGAAGGGCAAACTGGAAGG - Intronic
924262902 1:242250392-242250414 AAGGTGAAGGGGAATGGGGAAGG + Intronic
924761397 1:246990132-246990154 AAGGAGAAGGGGAAGGAGGGAGG + Intronic
1062767175 10:74702-74724 AAGGAGAAGGGGAAGGGAGAAGG + Intergenic
1062784031 10:245970-245992 AAGAAGAATGGAAAAGTGAATGG - Intronic
1062818514 10:517183-517205 ATGGAGAAGGGAAAAGGAGAAGG - Intronic
1063207576 10:3849122-3849144 AAGGGGAAGGGGAAGGGGGAGGG - Intergenic
1063286254 10:4692086-4692108 AAGGAGAAGGGGAACGGGAAGGG + Intergenic
1063330806 10:5157496-5157518 AGGGAGGAGGGCAGTGTGGAAGG - Intergenic
1063953599 10:11246468-11246490 AAGTAGAGGGGAAAGGAGGAGGG - Intronic
1064477378 10:15705776-15705798 GAGGTGAAGTGAAATGAGGATGG - Intronic
1064533026 10:16329545-16329567 AAGGAGAAGGGGAAAGGGAAGGG + Intergenic
1064628527 10:17285729-17285751 AGAGAGAAGGGAAAGGGGGAGGG + Intergenic
1064797501 10:19029748-19029770 AAAGAGAACGGAAAGGGGGAAGG - Intergenic
1065194339 10:23248062-23248084 CAGGAGAAGGGATGTGTGCATGG + Intergenic
1065203078 10:23331698-23331720 AGGGGGAAGGGAAAAGGGGAAGG + Intronic
1065384235 10:25117709-25117731 CAGGAAAGGGGAAATGTGGAGGG + Intergenic
1065933491 10:30499989-30500011 AAGAAGGAGGGAAAGGAGGAAGG + Intergenic
1066183194 10:32983323-32983345 AAGGAGAAGGGAAGTGGTGTGGG - Intronic
1066277659 10:33884722-33884744 ATGGAGAAGAGAGAAGTGGATGG - Intergenic
1066334611 10:34463142-34463164 AAGGGGAAGGGAAAGGGGAAGGG + Intronic
1066721884 10:38348062-38348084 AAGGTGAAGGGGAATGGGGAAGG - Intergenic
1067174911 10:43938879-43938901 AAGGAGGATGGAAACTTGGAGGG + Intergenic
1067399541 10:45958347-45958369 AAGGAGAAAAGAAATGTCTATGG + Intergenic
1067814163 10:49459376-49459398 AATGAAAAGGGAAAGGAGGAGGG + Intronic
1067867872 10:49927655-49927677 AAGGAGAAAAGAAATGTCTATGG + Intronic
1067925714 10:50506054-50506076 CAGGACAAGGGAGATGGGGAAGG - Intronic
1068104688 10:52599661-52599683 AATGAGATGGAAAATGTGAATGG + Intergenic
1068222033 10:54057259-54057281 GTGCAGAAGGGAAATGTGGGTGG - Intronic
1068329146 10:55538659-55538681 AGGAAGCAAGGAAATGTGGAAGG - Intronic
1068496535 10:57790626-57790648 AAGGAAAAAGAAAATGAGGAAGG + Intergenic
1068830661 10:61491198-61491220 AAGGAGAAGGGAAGGGAGGAAGG + Intergenic
1069125624 10:64628933-64628955 AAGGAGAGCTGAAAAGTGGATGG - Intergenic
1069286301 10:66719962-66719984 AAAGAAAAGGGTAAAGTGGAAGG + Intronic
1069755977 10:70774653-70774675 AAGGAGAAGGGGGAGGAGGAAGG - Intronic
1070199140 10:74186249-74186271 AGGGAGAAGGGAAAGGGGAAAGG - Intronic
1071186107 10:83047506-83047528 AAGGAAATGGGAAATGTGGGTGG - Intergenic
1071506708 10:86236781-86236803 ACAGAGAAGGAAAATGTGCATGG + Intronic
1071807737 10:89142760-89142782 AAGGAGAAGAGAAAGGAGAAGGG + Intergenic
1071972510 10:90922360-90922382 TGGGAGAAGGGAATTGTGAATGG + Intergenic
1072564993 10:96609981-96610003 AAGGGGAAGGGAAAAGACGATGG + Intronic
1072566170 10:96618434-96618456 AAGGTTAAGGGAAATGAGAAGGG - Intronic
1072613892 10:97036996-97037018 AAGGAGCCAGGAAAAGTGGAGGG - Intronic
1072718562 10:97767228-97767250 GAGGGTAAGGGAAAGGTGGAGGG - Exonic
1072974308 10:100044304-100044326 AAGGAGTGGTGACATGTGGAAGG + Intronic
1073077708 10:100835113-100835135 TTGGAGAAGGGAGATGTGGATGG - Intergenic
1073111193 10:101063868-101063890 AAGGGGAAGGGGGATCTGGAAGG + Intronic
1073476242 10:103755980-103756002 AGGGAGGAGGCAAATGTGGAGGG - Intronic
1073592120 10:104767605-104767627 AAGGAAAAGGGGAAGGGGGAAGG - Intronic
1074081264 10:110169836-110169858 AGGGAGAAGGGAGATGAGGAGGG - Intergenic
1074133198 10:110602537-110602559 ATGAAGAAAGGAGATGTGGAGGG + Exonic
1074453032 10:113574872-113574894 AGGGAGAAAGAAAAAGTGGAAGG - Intronic
1074577768 10:114686592-114686614 AGGGAGAAAGGAAAAGAGGAAGG - Intergenic
1074579540 10:114705538-114705560 AAGGAAACGGGAAATGGAGATGG + Intergenic
1075149098 10:119910643-119910665 ATGGAGAGGAGAAATGAGGAAGG - Intronic
1075387272 10:122064295-122064317 ATGGAGGAGGGAAGTGTGCATGG - Intronic
1075801233 10:125154811-125154833 AAGGAGAAGGGCTTTGTGAATGG + Intronic
1075907196 10:126091918-126091940 AAGGAGGAAGGAAGGGTGGATGG + Intronic
1076229100 10:128805175-128805197 GAGGAGCAAGGAAAGGTGGAAGG - Intergenic
1076257787 10:129042270-129042292 ATGGAGTAGGGAAGGGTGGATGG - Intergenic
1076571955 10:131438901-131438923 AGGGAGAAGGGAAGAGAGGAGGG - Intergenic
1076806201 10:132860189-132860211 AAACAGACGGGACATGTGGATGG + Intronic
1077180302 11:1209270-1209292 AGGGAAAAGGGAGAAGTGGAGGG - Intergenic
1077282202 11:1750903-1750925 AAGGAGGAGGGAGTTGGGGAGGG - Intronic
1077440074 11:2564244-2564266 TAGGAGAAGGGCAATGGGGATGG - Intronic
1077555481 11:3224021-3224043 GAGGGGAGGGGGAATGTGGATGG + Intergenic
1077640621 11:3878188-3878210 GGGGAGAAGGGAAAGGAGGAGGG + Intronic
1077644559 11:3912098-3912120 AGGGAGAAGGGAAAGGAGAAGGG - Intronic
1078082040 11:8211226-8211248 GAGGAGCAGAGAAAGGTGGATGG + Intergenic
1078143897 11:8710235-8710257 AATGGGAAGGGAAATGGTGAGGG + Intronic
1078255626 11:9656101-9656123 AAGAAAAAGGAAAAGGTGGAGGG + Intergenic
1078459116 11:11499833-11499855 CAGGTGATGGGTAATGTGGATGG + Intronic
1078603815 11:12757366-12757388 AAGGGAAAGGGAAATGGAGAAGG + Intronic
1078922813 11:15846066-15846088 AAGAAGAATGGAATTGAGGAGGG - Intergenic
1078961349 11:16276349-16276371 AAGGAGAAGGGAATCATGAATGG - Intronic
1079049586 11:17142096-17142118 AAAGAGAAAGGAAAGGTCGATGG + Intronic
1079055921 11:17207060-17207082 ATTGAGGAGGGAAATGAGGAAGG - Intronic
1079134646 11:17769503-17769525 AAGGAGAAAGGAAAGGAGGAAGG + Intronic
1079150712 11:17896677-17896699 AAGGGGAAGGGAAAGGGGAAGGG + Intronic
1079206155 11:18416723-18416745 ACGGAGAAGGGAAAGGGGGAAGG - Intronic
1079271288 11:18988310-18988332 AAAAAGAAGGGTAATGAGGATGG + Intergenic
1079536360 11:21520034-21520056 TAGGAGAAGAGAGATATGGAAGG + Intronic
1079615358 11:22486108-22486130 AAGGAGAAGGAGAAAGTGCAAGG + Intergenic
1079743660 11:24097763-24097785 AAGGAGAGAGGAAAGGTGGAAGG - Intergenic
1080384367 11:31802534-31802556 AAGGAGAGGGGAAAGTGGGAAGG + Intronic
1080397883 11:31906608-31906630 AAAGAGAAGGGAGAGGGGGAAGG + Intronic
1080438543 11:32268928-32268950 AAGGGGAAGGGGAATGGGAAGGG + Intergenic
1080517150 11:33034934-33034956 ACAGAGAGGGGAAAGGTGGAAGG - Intergenic
1080603219 11:33841337-33841359 AAGGAAAAGGGAAAGGAGGAGGG - Intergenic
1080711061 11:34748526-34748548 AAGGCACAGGGAACTGTGGATGG + Intergenic
1080969223 11:37250063-37250085 AAGGAAAAGAAACATGTGGAAGG + Intergenic
1081155472 11:39684415-39684437 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1081331120 11:41801332-41801354 AAGGAGAAAACAAATGTGGGTGG - Intergenic
1081371271 11:42306579-42306601 AAGGACAAGGCAAATGTAAAGGG - Intergenic
1081878541 11:46428175-46428197 AAGAAGAAGGGGAATGGGGAGGG + Intronic
1081967561 11:47178826-47178848 AAGGAGAAAGGAAAGGAGGGCGG + Intronic
1082033289 11:47623072-47623094 AAAGAGCAGGGAAAGGTGGCCGG + Intronic
1082132443 11:48506540-48506562 AAGGAGAAGGGAAGGGAGAAGGG - Intergenic
1082196797 11:49316251-49316273 AAGGAGAAGGGGAAGGGGTAAGG + Intergenic
1082225796 11:49705536-49705558 AAGGTGATTGGAAATGTGGAAGG + Intergenic
1082565871 11:54677089-54677111 AAGGAGAAGGGAAGGGAGAAGGG - Intergenic
1082735887 11:56855063-56855085 AGGGAGAAGGGAAAGGAGGGAGG + Intergenic
1083149987 11:60785833-60785855 GAGGAGAAGGGACTTGTCGAGGG + Intronic
1083477061 11:62921546-62921568 GAGGAGAAAGGACATGAGGAAGG + Exonic
1083659041 11:64243719-64243741 ATGGAGAAGGGTAATGGAGATGG - Intronic
1084569943 11:69953296-69953318 TAGGGTGAGGGAAATGTGGATGG + Intergenic
1085127048 11:74008924-74008946 AAGGAGAAGGGAGAGGGAGAGGG + Intronic
1085461420 11:76696112-76696134 AAGGAGTAGGGACATGGGAAGGG + Intergenic
1085508837 11:77075093-77075115 AAGGTGATGGGGAGTGTGGAAGG - Intronic
1085753961 11:79188647-79188669 AAGCAGAAGAGAAGTGAGGATGG + Intronic
1085802404 11:79602515-79602537 AAGTAAAATGGAAATGAGGAAGG + Intergenic
1085803283 11:79611474-79611496 CAGGAGAAGGGAAATGCAGAAGG - Intergenic
1085879402 11:80448208-80448230 AGGGAGAAGGGGAATGGGAAAGG - Intergenic
1086379250 11:86235092-86235114 AAGGAGAAAGGAAAAGAAGAAGG + Intergenic
1086500271 11:87445700-87445722 AAGGAGAAGGGACTTGAGGGGGG + Intergenic
1086623298 11:88914195-88914217 AAGGTGATTGGAAGTGTGGAAGG - Intronic
1086659027 11:89391934-89391956 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
1086880337 11:92146386-92146408 TAGGAGCAGGGAAATGGGGTGGG - Intergenic
1087538356 11:99482068-99482090 AAGGAAAAGGTAAATTTTGAGGG + Intronic
1087564836 11:99841652-99841674 AAGGAGAAGGAGAATGAAGAAGG + Intronic
1087611339 11:100437548-100437570 AAGGAGAAAGGAAAAGAGAAAGG + Intergenic
1087611345 11:100437577-100437599 AAAGAGAAAGGAAAGGGGGAAGG + Intergenic
1087814207 11:102640826-102640848 AAAGAGAAAGGAAAGGAGGAAGG - Intergenic
1087940724 11:104093753-104093775 AAGGAGAAGGAGAAGGTGGGTGG - Intronic
1087957367 11:104304946-104304968 GAGGAGAAGGGAAAAGAGAAAGG - Intergenic
1088076725 11:105858638-105858660 AGGGAGGAGGGAAATGGGGATGG - Intronic
1088419874 11:109634472-109634494 AAGGAGAAGGGAAAGGCAAAGGG - Intergenic
1088622024 11:111694811-111694833 AAGGGGAAGAGAAATGAAGAGGG - Intronic
1088717525 11:112561804-112561826 AGGGAGATGGGAGAAGTGGAAGG - Intergenic
1088735805 11:112726840-112726862 AAGGAGAAATCAAATGTGCATGG - Intergenic
1088793482 11:113247537-113247559 TCAGAGATGGGAAATGTGGAGGG - Intronic
1088879027 11:113959015-113959037 AATGGGAAGGGAAGTGGGGAAGG + Intergenic
1088986094 11:114909891-114909913 AAGGAGGAGGGAGATGTGGGAGG - Intergenic
1089249174 11:117144944-117144966 AAGGAGGAGGGAAAAGTGCTCGG - Intronic
1089476934 11:118771611-118771633 AGGGAGAAGGCAAAGGAGGAAGG + Intronic
1089591089 11:119541018-119541040 AAGAAGGAGAGAAATGGGGAAGG + Intergenic
1089744943 11:120610060-120610082 CAGGAGAAGGCAGATGGGGAGGG - Intronic
1089748507 11:120633800-120633822 AGGCAGAAGGGAAGTGTGGCTGG + Intronic
1089826837 11:121285258-121285280 AAGGAAGAGGGAAATATGTAAGG + Intergenic
1089851192 11:121498030-121498052 AATGAGAAGAGAGATGTGGGTGG + Intronic
1090003831 11:122983424-122983446 AAGGAGAAGGGAAGGGAAGAAGG + Intergenic
1090029315 11:123194368-123194390 AAGGAAAAGGGGAAAGGGGAAGG - Intronic
1090083906 11:123634079-123634101 GAGGGGAAGGCAGATGTGGATGG - Intronic
1090112321 11:123926963-123926985 AAAAACAAGGGAATTGTGGAAGG - Intergenic
1090475690 11:127018109-127018131 AGGGAAGAGAGAAATGTGGAAGG + Intergenic
1090892710 11:130940398-130940420 AAGGAGAAGAACAAGGTGGAAGG + Intergenic
1091209171 11:133842118-133842140 GAGGAGAAGGGCCAGGTGGAGGG + Intronic
1091493564 12:952951-952973 AGGGGGAAGGGAAAAGGGGAAGG + Intronic
1091800712 12:3323027-3323049 AAGGAGAAGGGAAGGGAGAAGGG + Intergenic
1091836341 12:3588757-3588779 ATGGGGAAGGGAACTGTGGGAGG + Intronic
1091964593 12:4727500-4727522 AAGTTGTAGGAAAATGTGGAGGG - Intronic
1092306300 12:7304524-7304546 AAGGAGAAGGTATATGACGATGG + Exonic
1092334292 12:7614991-7615013 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1092672610 12:10881179-10881201 AAGGAGAAGGGGGCTGTAGAAGG - Intronic
1093017648 12:14170973-14170995 AAGGAGAAGGGTAAAGGGAAGGG + Intergenic
1093459228 12:19393277-19393299 AAGGGGAAGGGGAAGGGGGAAGG + Intergenic
1094003455 12:25721792-25721814 CAGGGGAAGGGAAATGAGGGTGG + Intergenic
1094185860 12:27642001-27642023 ATGGTGAAGGGAAAAGTAGATGG + Intronic
1094349208 12:29504589-29504611 AAGGAAAAGGGAAAAGGGGTAGG + Intronic
1094380758 12:29840663-29840685 AAGGGGAAGGGAAAAGTGAAGGG - Intergenic
1094424553 12:30304831-30304853 CAGGAGAAGGGAATTGAAGATGG + Intergenic
1094523699 12:31218390-31218412 AAGGACAAGGGGAAAGGGGAAGG + Intergenic
1094772749 12:33684479-33684501 AGGGAGAAGGGGAAGGGGGAGGG - Intergenic
1094843627 12:34352097-34352119 AAGGGGCAGGGAAACGTGAAAGG - Intergenic
1096001048 12:48130956-48130978 AAGGAGAAGGGGAAGTTGGTGGG - Intronic
1096220476 12:49825847-49825869 CAGGTGAAGGGGAATGTTGAAGG - Intronic
1096229875 12:49890869-49890891 AGGGAGAAGGGGAATGGAGAAGG - Intronic
1096231594 12:49899939-49899961 GAGGATATGGGAAATGAGGAAGG + Intronic
1096568181 12:52498608-52498630 AGGGAGATGGGAACTGGGGAAGG - Intergenic
1096603084 12:52744302-52744324 AAAGAGAAGGGAAGGGAGGAAGG + Intergenic
1096656769 12:53097219-53097241 GAGGAGTGGGCAAATGTGGAGGG - Intergenic
1097198961 12:57261901-57261923 AAGGAGAGGGGACGTGTGAATGG + Intronic
1097658286 12:62396649-62396671 AAGGGGAAGGAGAACGTGGAGGG - Intronic
1097908811 12:64947685-64947707 ATGGAGAAGGGAAAGGCTGAAGG - Intergenic
1098183836 12:67876220-67876242 AAGGGAAAGGGAAAGGTAGAGGG + Intergenic
1098245947 12:68517983-68518005 AAGAAGAAAGGAAAAATGGATGG + Intergenic
1098389696 12:69956541-69956563 AAGAAGAAAGGAAATGTGGAGGG - Intronic
1098739480 12:74154172-74154194 AAGGGGATGGGAGAGGTGGAGGG + Intergenic
1098754170 12:74337142-74337164 GTGGAGAAGGAAAATGTGGTAGG + Intergenic
1098907936 12:76180701-76180723 AAGGAAAAGTGAACTGTGAATGG + Intergenic
1099335567 12:81352339-81352361 CAGGAAAAGGGAAAGGTGGGTGG + Intronic
1099578151 12:84406024-84406046 ATGGTGAAGAGATATGTGGATGG + Intergenic
1099852656 12:88122210-88122232 TAGGAGAATAGATATGTGGATGG - Intronic
1099862479 12:88237625-88237647 AAGGAGAAGGGAAAGATAAAGGG - Intergenic
1099868074 12:88309531-88309553 AAGGAGGAGGGAAAGAAGGAAGG - Intergenic
1100184984 12:92129118-92129140 AAGGAGAGGGGAAGTTGGGAGGG + Intronic
1100232258 12:92620339-92620361 CAGAAGAAGGGAGATGTTGAAGG - Intergenic
1100250370 12:92815365-92815387 AAGGGGGAGGGGAATGAGGAGGG - Intronic
1101418664 12:104531067-104531089 AAGGAGAAGGGAAGAGATGAAGG - Intronic
1101484054 12:105133123-105133145 ATGGGGAAGGGATTTGTGGAAGG - Intronic
1101519091 12:105465121-105465143 AGGGAGAATGGACATTTGGAAGG + Intergenic
1101746718 12:107547210-107547232 AAGGAGAAGGGGGAGGGGGAGGG + Intronic
1101797437 12:107988454-107988476 AAGGAGGAGGGAAAGAAGGAGGG + Intergenic
1101861882 12:108489146-108489168 AAGGAGAAGGGAAAGAGGGAAGG + Intergenic
1102166744 12:110812994-110813016 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1102223095 12:111208034-111208056 AAGGAGAAGGGGAAGTGGGAGGG + Intronic
1102240002 12:111319303-111319325 AAAGGGAAGGGAAATGAGGAAGG + Intronic
1102542652 12:113633762-113633784 AAGGAGAAGGGATATTGGGCAGG + Intergenic
1102833706 12:116032898-116032920 AAGGAGAAAGGAAAAGAAGACGG + Intronic
1102844016 12:116158266-116158288 AAGGTGAAGGGAAGAGGGGATGG + Intronic
1103151859 12:118647787-118647809 AAGGAGAAAAGAAATATGGAAGG + Intergenic
1103206915 12:119136944-119136966 AAAGAGAAGGGAGATGTGCCGGG - Intronic
1103246752 12:119464419-119464441 AAGAAGAAAGGAAAGATGGAAGG - Intronic
1103371572 12:120423323-120423345 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1103862738 12:124027384-124027406 AAGGAAAAGGGAAATGAAGGAGG - Intronic
1103962349 12:124617072-124617094 AACGAGAGGGCAGATGTGGAGGG - Intergenic
1104134388 12:125923484-125923506 AAGGAAAAGGGAGAGGTGAAGGG + Intergenic
1104273704 12:127305483-127305505 AATGAGATGGGAGCTGTGGAGGG + Intergenic
1104390325 12:128386426-128386448 ACGGAAAGGGAAAATGTGGAGGG - Intronic
1104435316 12:128751436-128751458 TGGGAGAGGGGAAATGGGGAAGG + Intergenic
1104499293 12:129269371-129269393 AAGGAGAAGGCAAAGGGGAAGGG - Intronic
1104524282 12:129503850-129503872 GAGGAGGAGGAAAATCTGGAAGG - Intronic
1104606124 12:130189696-130189718 AAAGAGAAGAGTAATGAGGAGGG - Intergenic
1104714397 12:131006692-131006714 GAGGATGAGGGAAATGAGGAGGG + Intronic
1104759220 12:131287091-131287113 AGGAAGGAGGGAAATGTGGAGGG - Intergenic
1104769293 12:131350946-131350968 AAGAAGATGTGGAATGTGGAGGG + Intergenic
1104821391 12:131679405-131679427 AGGAAGGAGGGAAACGTGGAGGG + Intergenic
1105003763 12:132708372-132708394 GGGGAGAAACGAAATGTGGAAGG + Intergenic
1105059432 12:133134980-133135002 ATGGAGAAAGGAAATGTGGCTGG - Intronic
1105247796 13:18668131-18668153 AATGAGAATGGAAAATTGGAAGG - Intergenic
1105652588 13:22396020-22396042 AAAGAGAACTGAAATTTGGAAGG + Intergenic
1105984631 13:25553286-25553308 TAAGAGAAGGGATATCTGGACGG - Intronic
1106132771 13:26953250-26953272 AAGGAGAAGGGAAGGGAGGGGGG + Intergenic
1106276181 13:28209796-28209818 AAGGAGAAAGGAAAAAGGGAAGG - Intronic
1106360042 13:29022638-29022660 AATGAGGAGGAAAGTGTGGAAGG + Intronic
1106563228 13:30864296-30864318 AATGAGAAGGAAGATGTGGAGGG - Intergenic
1106584984 13:31049040-31049062 AGGGAGAAGGGATGTCTGGAGGG + Intergenic
1106771511 13:32965278-32965300 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1106808240 13:33333421-33333443 AGGGAGGAGGGAAATGGAGAAGG - Intronic
1106927277 13:34626192-34626214 AGGGAGAAGGGAAAGGAGGGAGG + Intergenic
1106970174 13:35130242-35130264 AAAGAGAAGGGTAAAGTGGTAGG + Intronic
1107178535 13:37428654-37428676 AAGAAAAAGGGAAATGCAGAGGG + Intergenic
1107288033 13:38818540-38818562 AAGGAGAAAGGAGAGGTAGATGG + Intronic
1107481027 13:40786458-40786480 ATGGAGAGGAGAAATGTGGAAGG + Intergenic
1107659185 13:42621750-42621772 AAGCAGAAGAGAAAGGAGGAAGG + Intergenic
1107761196 13:43681091-43681113 GAGGAGAAGGGAAAGGGGCAGGG - Intronic
1107795451 13:44046897-44046919 AAGGAGAAGGGGAAGGGGAAAGG - Intergenic
1107795460 13:44046921-44046943 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1107819910 13:44277181-44277203 AAGGGGAAGGGAAAGAGGGAGGG + Intergenic
1107822370 13:44297285-44297307 AGAGAGGAGGGAAATGGGGAAGG + Intergenic
1107880820 13:44830506-44830528 AAGGAGATGTGAATTGTGGATGG - Intergenic
1108275381 13:48804119-48804141 AAGGACAAGGGACAGGTGGATGG - Intergenic
1108283356 13:48881460-48881482 AAGGAGAATGGAGAGGAGGAAGG + Intergenic
1108405470 13:50096510-50096532 AAGAAGAAAGGAAAGGTGAAGGG - Intronic
1108676788 13:52743917-52743939 AAGGGTGTGGGAAATGTGGAGGG + Intergenic
1109154425 13:58888347-58888369 ATGAAGAACTGAAATGTGGAGGG + Intergenic
1109181504 13:59219605-59219627 AAGGAAAAGAGAAATGTTCATGG + Intergenic
1109556916 13:63988463-63988485 AAGGGGAAGGGAACTGATGAAGG + Intergenic
1110564712 13:76946644-76946666 AAGGAGAAGAAAAAGGTAGAAGG + Intergenic
1110667100 13:78129831-78129853 AAGGAGAAAGGAGAGCTGGAGGG - Intergenic
1110873992 13:80487257-80487279 CTGGAGAAGATAAATGTGGATGG + Intergenic
1110927289 13:81169870-81169892 TAGGAAAAGGGAAAAGTAGAAGG - Intergenic
1111133948 13:84014152-84014174 AAGGAGAAGGGAGAAGGGAATGG + Intergenic
1111700871 13:91686279-91686301 AATGAGGAGGGAAATGAGGGAGG + Intronic
1111995109 13:95158125-95158147 AAGGGGAAGGTAAACCTGGAAGG - Intronic
1112625445 13:101098369-101098391 TAGGTGAAATGAAATGTGGAAGG - Intronic
1112788991 13:102982808-102982830 AAGGAGGAGGAAGATGAGGAGGG + Intergenic
1113166272 13:107447149-107447171 AAGGAGAAGAGGAAGGAGGAAGG - Intronic
1113166869 13:107452424-107452446 AAGGAGAAGGGCCAAGTGAATGG + Intronic
1113374149 13:109748580-109748602 AAGGAGAAAGGAGAGGTGAATGG + Intergenic
1113428612 13:110230452-110230474 AGAGAGAAAGGAAAAGTGGATGG + Intronic
1113909847 13:113836632-113836654 GAGGAGAGGGGAAATAAGGATGG + Intronic
1114147559 14:19994784-19994806 AAGAAGACTGGAAATGGGGAGGG - Intergenic
1114179177 14:20350929-20350951 AGGGAGAAGGGAAAGGTGAAAGG - Intronic
1114257296 14:21014297-21014319 AAAGAGAAGGAAAAAGAGGAAGG + Intergenic
1114410439 14:22495791-22495813 AAGGAGAATGGAACTGTGTGTGG + Intergenic
1114876037 14:26719401-26719423 AAGCAGAAGTAAAATGTAGAGGG + Intergenic
1115053064 14:29088720-29088742 GTGGAGAGGGGAAATGGGGATGG + Intergenic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115529359 14:34312796-34312818 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
1115865639 14:37743663-37743685 AATGAGAAGGGATTTGTGGGTGG + Intronic
1115924922 14:38421982-38422004 GAGGAGGAGGGAAGTGGGGATGG - Intergenic
1116043483 14:39714677-39714699 GTGGAGAAGGGCAATGTGAAAGG - Intergenic
1116609728 14:47052864-47052886 AAGGAGAGGGGAAAATGGGAAGG - Intronic
1116761692 14:49022758-49022780 AAGGACAAGGCAACTGAGGAAGG - Intergenic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117265340 14:54080486-54080508 ATGGGGAAGAGAAATATGGATGG - Intergenic
1117300351 14:54419754-54419776 AAGGTGAAATGAAATGTAGATGG - Intronic
1117471909 14:56054841-56054863 AAGGAAAAGGGAAAAGGAGAGGG - Intergenic
1117616176 14:57535976-57535998 AAGGAGAAGGAAAATATCTATGG + Intergenic
1117670384 14:58100197-58100219 AAGGAAAAGAGAAATGTTGGTGG + Intronic
1117715009 14:58571629-58571651 AAGGGGGAGGGAAAGGTGCAAGG - Intergenic
1117730800 14:58719991-58720013 ATGGAGAAGGCAAAAATGGAAGG + Intergenic
1117861367 14:60095593-60095615 AAAAAGAAGGGAAATGTGAAAGG - Intronic
1117872369 14:60214358-60214380 AATAAGTAGGGAAATGTGTATGG - Intergenic
1118207873 14:63740112-63740134 AAGGCGAGGGGAAACATGGAAGG - Intergenic
1118706225 14:68483014-68483036 TAGGGGAAGGGAAAGGTGGATGG + Intronic
1118908408 14:70040803-70040825 GAGGAGAAGGGAACTGTGGGAGG + Intergenic
1118946150 14:70389296-70389318 TGGGAGAAGGAAAGTGTGGAAGG - Intronic
1119123936 14:72106548-72106570 AAGGAGAAAGGAATTATGGCTGG - Intronic
1119299454 14:73559910-73559932 AAGGGGAATGGAAAAGTCGACGG - Intergenic
1119923602 14:78470681-78470703 AAAGAGAAGAGAAATGGAGATGG + Intronic
1119977362 14:79040064-79040086 AGCGAGATGGGAACTGTGGAAGG - Intronic
1120281453 14:82443663-82443685 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1120655856 14:87189132-87189154 AAGCAGAAGGAGAATTTGGATGG - Intergenic
1120694386 14:87628229-87628251 AAGGAAAAGGGAAATGAGTGGGG - Intergenic
1121019793 14:90572972-90572994 AAGGAGAAGGGGAAAGTGATGGG - Intronic
1121037161 14:90715909-90715931 AAGGAGAAAGGAGAGGAGGAAGG - Intronic
1121121844 14:91380904-91380926 AAGGAGAATGGGAACTTGGAAGG + Intronic
1121144207 14:91569434-91569456 AAGGAGGAGGAAAAAGAGGAAGG - Intergenic
1121166883 14:91810352-91810374 AAGGAGAAAGGGAAGGAGGAAGG + Intronic
1121186163 14:91971617-91971639 AAGGGGAAGGGAAGAGAGGAAGG + Intronic
1121396289 14:93626156-93626178 TAGGAGACTGGAAATGTGAATGG - Intronic
1121496454 14:94394832-94394854 AAGGAGAATGGAAAGAGGGACGG - Intergenic
1121593270 14:95137180-95137202 AAGGAGAAGGAAAAGGGGAAGGG + Intronic
1121593363 14:95137488-95137510 AAGGGGAAGGGAAAGGGGAAGGG + Intronic
1121593371 14:95137512-95137534 AAGGAAAAGGGAAAGGGGAAAGG + Intronic
1121593388 14:95137561-95137583 AAGGGGAAGGGAAAGGGGAAGGG + Intronic
1121607675 14:95253182-95253204 AAGGACAAAGGAACTGAGGAAGG + Intronic
1122002119 14:98667136-98667158 AAGGAGAGAGGAAAGGAGGAAGG - Intergenic
1122640096 14:103154788-103154810 AAGGGGAAGGGGAAGGTGGCAGG + Intergenic
1123147326 14:106145721-106145743 AAGGAAAATAGAAATGTGTATGG - Intergenic
1123756664 15:23402281-23402303 AAGGAGAAAGGAAAGAAGGAAGG + Intergenic
1124060770 15:26291937-26291959 AAGGAAAAGGGAAAATTGAAAGG + Intergenic
1124547599 15:30645931-30645953 AAAGAGATGGGAAATATAGAAGG + Intronic
1124716151 15:32064243-32064265 AAGGGGAAGGGAAAGGGGCACGG - Intronic
1124957776 15:34370922-34370944 GAGGAGAAGGGAAGTGAGGAAGG - Intergenic
1125094730 15:35838139-35838161 AATGAGAAGGGAAATGGGATTGG + Intergenic
1125539341 15:40460758-40460780 CAGGGGAAGGGAGATCTGGAAGG - Intronic
1125697553 15:41651803-41651825 GAGGAGAAGGGAAAGGAAGAGGG - Intronic
1126393912 15:48191500-48191522 AAGGAGGTGGGAGATGAGGAGGG - Intergenic
1126722590 15:51597267-51597289 ACGGAGAAGTGTAATTTGGAAGG - Intronic
1127107855 15:55636371-55636393 AAGGAGAAGGAAACACTGGAAGG - Intronic
1127185506 15:56475639-56475661 AGGGTGGAGGGAAATCTGGAGGG + Intergenic
1127189999 15:56519182-56519204 AAGGAGAAAGGAAAGGGGAAAGG + Intergenic
1127341391 15:58048524-58048546 ATTGAGAAGGGAAGTATGGATGG + Intronic
1127446391 15:59067343-59067365 AAGGGGAAGGGAAAGGAGAAAGG - Intronic
1127517808 15:59713373-59713395 AAGGGGAAGGGAAGGGAGGAAGG - Intergenic
1127691117 15:61398660-61398682 AGGGAGAGGGGAAAGGTGGAGGG + Intergenic
1127843459 15:62849341-62849363 AAAAAGAAGGGAAAGGTAGAGGG + Intergenic
1127891575 15:63256586-63256608 GGGGAGAAGGTAAATGTGAATGG + Exonic
1127906526 15:63380253-63380275 AAGGAGGAGGGAAAGGGAGAGGG + Intronic
1127973018 15:63977101-63977123 AAAGAGAAGGGGAAGGGGGAAGG + Intronic
1128210365 15:65895671-65895693 GAGGAGAAGGGAAAGGCAGAGGG - Exonic
1128258680 15:66216754-66216776 GAGGAGGAGGGATATGTTGAAGG + Intronic
1128290827 15:66477085-66477107 GAGGAGAAGGGAAATTCTGAGGG - Intronic
1128304132 15:66586984-66587006 AGGGGGAAGGGAAGTGGGGAGGG - Intronic
1128370532 15:67036004-67036026 GAGGAGAAGGGAAGTGAGGTGGG - Intergenic
1128557465 15:68641478-68641500 AAGGAGCAGGGAAAAGGAGAAGG + Intronic
1128738248 15:70065821-70065843 AAGGAGTAGGAAAAGGTGCATGG + Intronic
1129044968 15:72725948-72725970 AGGGGGAAGGGAAAGGAGGAAGG - Intronic
1129095302 15:73200547-73200569 AAAGGGAAGGGAAATGGGAAAGG + Intronic
1129480825 15:75824305-75824327 CAGGAGAAGGGATATCTGGGAGG - Intergenic
1129518890 15:76173278-76173300 TTGGAGAGAGGAAATGTGGAGGG + Intronic
1129880974 15:79005813-79005835 AAAGAGAAAGGAAATGAGGAGGG - Intronic
1129978594 15:79845928-79845950 AATGGGAGGGGAAATGAGGAGGG - Intronic
1130130404 15:81136359-81136381 AAGGGGAAGGGAAAGGAAGAAGG + Intronic
1130162634 15:81416402-81416424 AGGGAGAGGAGAAATGTGGTAGG - Intergenic
1130197472 15:81794104-81794126 AAGGCCAGGGTAAATGTGGAGGG + Intergenic
1130230683 15:82094579-82094601 AAGGTGATGGGAAAAGTGGATGG + Intergenic
1130727204 15:86451636-86451658 AAGGAGAAATGAATAGTGGAAGG + Intronic
1130735031 15:86538915-86538937 AAGGAGGAAGGAGATGAGGAAGG + Intronic
1130959867 15:88652484-88652506 AAGGAGGAGGGGAAGGAGGAGGG - Intronic
1130959872 15:88652496-88652518 AAGGAGGAGGGGAAGGAGGAGGG - Intronic
1131683143 15:94744895-94744917 AAGGAGAAGGGAAAGGAGGGAGG + Intergenic
1131780064 15:95846328-95846350 AGGGAGAAGGGAAGAGAGGAGGG + Intergenic
1132085255 15:98903310-98903332 AAGAAGAAGGAAAAAGTAGATGG + Intronic
1132457524 16:32397-32419 AAATAGAAGGGACATGTGGGTGG - Intergenic
1132716496 16:1292667-1292689 AAGGAGAGGGGAGAGGGGGAGGG - Intergenic
1133758654 16:8781055-8781077 AGGGAAAAAGGAAGTGTGGAGGG + Intronic
1133816313 16:9200010-9200032 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1134253001 16:12587896-12587918 AGGCAGGAGGGGAATGTGGAGGG - Intergenic
1134352619 16:13451929-13451951 AAGGAGAAGGGGAAGGGAGAAGG + Intergenic
1134459672 16:14420459-14420481 AAGGAGAAAGGAAAGAAGGAAGG - Intergenic
1134749731 16:16616375-16616397 AAGGTGTAAGGAAATATGGAAGG + Intergenic
1134770602 16:16806044-16806066 AAGGAGAAGGGGGAAGGGGAAGG - Intergenic
1134860146 16:17553612-17553634 AAGGAGAAGGGATGGGTAGATGG + Intergenic
1134995741 16:18737240-18737262 AAGGTGTAAGGAAATATGGAAGG - Intergenic
1135638616 16:24100622-24100644 AAGGAGAAAGGACAGGTGGTGGG - Intronic
1135717246 16:24782140-24782162 AGGGAGATGGGAAAAGTGGGAGG - Intronic
1136552331 16:30988325-30988347 AAAGAAAAAGAAAATGTGGAGGG - Exonic
1136598422 16:31267397-31267419 TAAGAGAAGGGGAAAGTGGAGGG - Intronic
1136945625 16:34648041-34648063 CAGGAGGAGGCAAATGTGTAGGG - Intergenic
1137348251 16:47685037-47685059 CAGAAGAAAGAAAATGTGGAAGG - Intronic
1137424325 16:48365033-48365055 AAAAAGAAGCGAAATGTGAACGG + Intronic
1138055346 16:53827215-53827237 TAGAAGAAGAGAAATGTGGGTGG - Intronic
1138241856 16:55433882-55433904 GAGGAGAAGGAAAATGAGGCAGG + Intronic
1138294721 16:55876494-55876516 AAGGAGAAGGGAACAGAGGTAGG + Intronic
1138395789 16:56703730-56703752 AAGGAAGAGGCAAATGTGGGTGG - Intronic
1138420271 16:56894537-56894559 AAGGAGATAGGGAATGAGGAGGG - Exonic
1138487097 16:57352781-57352803 AGGGAGAGGGGTAATGGGGAGGG + Intergenic
1138520300 16:57567283-57567305 AGGGAGATGGGAGATGTGGAGGG + Intronic
1138579411 16:57930558-57930580 AAGGAGGAGGGGAAGGGGGAGGG + Intronic
1139060940 16:63250684-63250706 AAGAAGAAGGGGAAGGCGGAGGG + Intergenic
1139060952 16:63250714-63250736 AAGGAGGAGGGAAAGGGAGAGGG + Intergenic
1139085196 16:63576338-63576360 AAGCAGATGAGAAATTTGGAGGG + Intergenic
1139413922 16:66790302-66790324 GAGGAGAAGGGAAAGGAGGGAGG + Intronic
1139908756 16:70383641-70383663 AAGGAGAAAGGAAAGGAGAAAGG + Intronic
1140387214 16:74551792-74551814 AAAGAGAAGGGAAGTGGGGAAGG + Intronic
1140781928 16:78304925-78304947 AGGAAGAAGGGAAAAGAGGAAGG - Intronic
1140799899 16:78476866-78476888 AAGAAGATGGGAAATCAGGAAGG - Intronic
1141034265 16:80614242-80614264 TCGGAGACGGGAAATGTGGCCGG - Intronic
1141190897 16:81823939-81823961 AAGGGAAAGGGAAAGGAGGAAGG - Intronic
1141527098 16:84618418-84618440 AAGGAGGAGGGAGAGGAGGAAGG - Intergenic
1141535384 16:84676248-84676270 CTGGAGAAGAGACATGTGGATGG + Intergenic
1141797541 16:86285406-86285428 GAGGAGAAGGGAATAGGGGAGGG - Intergenic
1141805477 16:86338725-86338747 AAGGAGAAAGGAGATGGGGTTGG - Intergenic
1141862528 16:86727729-86727751 AAGGAGAAAGAAAATATGGTCGG + Intergenic
1141896052 16:86959365-86959387 AAGGGGAAGGGGAAGATGGATGG + Intergenic
1141908304 16:87041853-87041875 AAGGAGAAGTGGAATTAGGAGGG - Intergenic
1142251462 16:88993815-88993837 AAGGAGGAGGGAAGAGAGGAGGG - Intergenic
1203113784 16_KI270728v1_random:1469528-1469550 AAGGAGAAGGGAAGGGAAGAGGG - Intergenic
1142556294 17:780374-780396 AAGGAGATGGGATATCAGGATGG - Intronic
1142788072 17:2240887-2240909 AAGAAGATGTGAAATGTGGGCGG - Intronic
1142958241 17:3535438-3535460 AAGGAGGAAGGAAGTGAGGAGGG - Intronic
1143473931 17:7192468-7192490 ATGGAGAAAGGAACCGTGGAGGG + Intronic
1143891335 17:10104780-10104802 GTGGAGAAGGAAAATGTGGATGG - Intronic
1143952926 17:10647870-10647892 AAGAAGAAGGGAGAAGAGGAAGG - Intronic
1144002044 17:11064245-11064267 AAAGAGAAGGGGCATATGGATGG + Intergenic
1144142168 17:12360286-12360308 AGGGAGCAGGGGAATGAGGAGGG - Intergenic
1144499727 17:15775539-15775561 AAGGAGAAAGGGAAGGAGGAAGG - Intergenic
1144589791 17:16514410-16514432 GAGGAGCAGGGAAATGCTGAGGG - Intergenic
1144620700 17:16816679-16816701 CAGGAGAAGGAAAAAGGGGAGGG + Intergenic
1144750788 17:17646959-17646981 AAGGAGAAGGGGGATGTGCGGGG + Intergenic
1144884942 17:18451468-18451490 CAGGAGAAGGAAAAAGGGGAGGG - Intergenic
1145147279 17:20492909-20492931 CAGGAGAAGGAAAAAGGGGAGGG + Intergenic
1145783013 17:27576086-27576108 AAGGAGGAGGGGAATGGGGGTGG - Intronic
1145831531 17:27920417-27920439 AAGGAGCAAGGAAAGATGGAAGG - Intergenic
1145846542 17:28042975-28042997 GAGGAGGAGGGAGGTGTGGAAGG - Exonic
1146123732 17:30216277-30216299 AAGGAGAAGGGAGCGGGGGAGGG + Intronic
1146904276 17:36608208-36608230 AAGGACAAGGGAAGAGAGGACGG - Intronic
1146916753 17:36682886-36682908 AAGGAGAAGGCACAAGGGGAGGG - Intergenic
1147374637 17:40016354-40016376 AAGGATAAGGCTAATGAGGAGGG + Intronic
1147856174 17:43482125-43482147 AAGAGGAAGCGAAATGGGGAGGG + Intergenic
1147881567 17:43657561-43657583 AAGGAGATGGCAAAGGAGGAAGG + Intronic
1148589982 17:48808933-48808955 AAGGAATAGAGAAAGGTGGAAGG - Intronic
1149028472 17:52057311-52057333 GAGGAGGAGGGAAAAGAGGAAGG - Intronic
1149237473 17:54609630-54609652 AAGGAAAAGGGAAATGTGACAGG + Intergenic
1149520688 17:57316161-57316183 AAGGAGAAGGGAAATCTATCTGG + Intronic
1149653278 17:58292425-58292447 AAGGAAAAGAGAAAAGTGGGAGG - Intergenic
1149785795 17:59433889-59433911 GAGGAGAGGGGAAAGGAGGAGGG - Intergenic
1150222014 17:63501066-63501088 AGGGAGAAGTGACATGGGGAGGG - Intronic
1150309827 17:64118973-64118995 GAGGAGAAGGGATTTGTAGAAGG - Intronic
1150425190 17:65072008-65072030 AAGGAGTAGGGAAAGGCAGATGG + Intergenic
1151272319 17:73006456-73006478 AAGGGGAAGGGAGAAGAGGATGG + Intronic
1151470003 17:74312066-74312088 AAGGAGAAGGGTAAGGCGGAGGG + Exonic
1151517804 17:74607638-74607660 AGGGTGGAGGGCAATGTGGAGGG + Intergenic
1151814635 17:76465684-76465706 AATGAGAAGGAAAATAAGGAGGG - Intronic
1152107231 17:78337756-78337778 AAGGAGAAGGGGAAGGTGACTGG - Intergenic
1152369511 17:79877694-79877716 AAGGAGAACGCAGAGGTGGATGG - Intergenic
1152609221 17:81307449-81307471 AAGGGGAAGGGGAAGGGGGAGGG - Intergenic
1152609241 17:81307491-81307513 AAGGAGAAAGGGAAAGTGAAGGG - Intergenic
1152609255 17:81307532-81307554 AAGGGGAAGGGGAAGGGGGACGG - Intergenic
1153684582 18:7532961-7532983 AAGCAGAAGAGACATCTGGATGG + Intergenic
1153718943 18:7881698-7881720 AAGGAGAAGGGAAGAGGGTACGG - Intronic
1153962876 18:10154298-10154320 AAGGAGAAGAAAAATGATGAAGG + Intergenic
1154095775 18:11413744-11413766 AAGGGGAAGGGAAGGGAGGAAGG - Intergenic
1154111936 18:11577692-11577714 AAGGGGAAGGGGAAGGTGGGAGG + Intergenic
1154247597 18:12713496-12713518 AAGGAAAGGGGACATCTGGAAGG + Intronic
1154393498 18:13965416-13965438 AAGGAGAAGGGCCAAGTGAAGGG + Intergenic
1154949095 18:21190865-21190887 AGGGGGAAGGGAACTGGGGAAGG - Intergenic
1155091814 18:22519424-22519446 AAGGAGAAGGTTAATTTTGAAGG + Intergenic
1155119629 18:22805070-22805092 AAGGAGAAGGAGCATGTGTAAGG + Intronic
1155124037 18:22853736-22853758 AAAGAAAAAGAAAATGTGGAGGG - Intronic
1155250756 18:23951311-23951333 AAGGATATGTGAGATGTGGAAGG - Intronic
1155497301 18:26455336-26455358 AAGGAAAAAAGAAATATGGATGG + Exonic
1155738269 18:29251801-29251823 AAGGAGCAAGGAACTGAGGAAGG + Intergenic
1155797382 18:30057563-30057585 AAGGAGAAGGGAAGGAAGGAAGG - Intergenic
1155797396 18:30057663-30057685 AAGGAGAAGGGAAGGAAGGAAGG - Intergenic
1155807111 18:30185151-30185173 AAGGGGAAGTGAAAAGGGGATGG - Intergenic
1155868757 18:30998974-30998996 AAGAAAAAGAGAGATGTGGAGGG + Intronic
1155960839 18:31993501-31993523 AAGGGGAAGGGGCATGTGTAAGG + Intergenic
1156063713 18:33114802-33114824 TAGGAGAAGTGAGAAGTGGAGGG + Intronic
1156135181 18:34029078-34029100 AAAGATAAGGGAACTGTGTAGGG + Intronic
1156421547 18:36959582-36959604 GAGGAGAAAGGAAAGGGGGAGGG - Intronic
1156535743 18:37862990-37863012 AGAGAGAAAGGAAAAGTGGATGG + Intergenic
1156557578 18:38084910-38084932 AAGGAGGAGAGCAAGGTGGAAGG + Intergenic
1156631536 18:38975295-38975317 AAGGAAAAGGAGAGTGTGGAAGG - Intergenic
1157187389 18:45552326-45552348 AAGGAGAAGGGGAATGCAGCTGG + Intronic
1157237603 18:45979182-45979204 AAGGAGAAGGGAGAGGGAGAGGG - Intergenic
1157748437 18:50157567-50157589 GGGGAGAAGAGAAATGTGGCTGG - Intronic
1157800928 18:50620512-50620534 AAGCAGAAAGTAAATGTTGATGG - Intronic
1158146962 18:54325155-54325177 CAGGATAAGGGAAATGAGGGAGG - Intronic
1158154334 18:54408329-54408351 AAAGAAAAGGGAAAGGAGGAAGG - Intergenic
1158538871 18:58334276-58334298 AAGGGAAAGGAACATGTGGACGG - Intronic
1158672873 18:59492527-59492549 AAGGAGAAGGGGAAGGAGGGAGG - Intronic
1158903912 18:61992435-61992457 AATGAGAAGGAAAATGGGGAGGG + Intergenic
1159087348 18:63809065-63809087 AATGGAAAGGGAAGTGTGGATGG + Intergenic
1159511891 18:69405012-69405034 GGGAAGCAGGGAAATGTGGAGGG + Intronic
1159933083 18:74334305-74334327 AAGCAGAAGGGGAAAGAGGAAGG + Intronic
1160040680 18:75342728-75342750 AAGGCGAAGGGAAGAGTGGGAGG - Intergenic
1160147158 18:76375235-76375257 AAGGAGAAAGGAAATGCGGAAGG + Intronic
1160333271 18:78014821-78014843 AAAGAGAAGGGATATGTGGGTGG + Intergenic
1160535527 18:79589557-79589579 AGGGAGAAGGGAGATGGGGAAGG + Intergenic
1160676843 19:395529-395551 ATGGAGAAGGGTGATGGGGAAGG + Intergenic
1160736591 19:665424-665446 AAGGAGAGGGGACTTGGGGAAGG - Intergenic
1161241646 19:3226404-3226426 AAAGAGATGGGGAATGGGGAGGG - Intronic
1161268243 19:3375097-3375119 GAGGAGAGGGGAAGTGGGGAGGG + Intronic
1161712112 19:5854700-5854722 AAAAAGAAAGGTAATGTGGATGG - Intergenic
1162066018 19:8126024-8126046 AAGGAGGAGGGAAAGCCGGAGGG + Intronic
1162226309 19:9225512-9225534 AAGGAGAGGGGAATTGAGGATGG + Intergenic
1162686187 19:12386485-12386507 AAGGGGAAGGGAAAGGGGAAGGG + Intronic
1162686192 19:12386497-12386519 AAGGGGAAGGGAAAGGGGAAGGG + Intronic
1163078185 19:14915257-14915279 AATAAGAAGGAAAGTGTGGACGG - Intergenic
1163272305 19:16261672-16261694 AAGTGGAATGGACATGTGGAAGG + Intergenic
1163695763 19:18762547-18762569 AGGGATATGGGAAATGTAGATGG - Intronic
1163804883 19:19389669-19389691 CAGGGGAAGGGAAAGTTGGAGGG + Intronic
1163851531 19:19666953-19666975 AAGGAGAAAGGAAATGTAATAGG + Intergenic
1163884648 19:19955107-19955129 AAGGAGAAGGGGAAAGAAGAAGG + Intergenic
1164292383 19:23879995-23880017 GAGAAGAAGGGAAAGGAGGAGGG + Intergenic
1164544855 19:29151867-29151889 AAGGGAAAGGGAAAGGAGGAAGG + Intergenic
1164581719 19:29439028-29439050 AAGGAGAAGGGGAAGGAGGGAGG + Intergenic
1164592624 19:29514554-29514576 AAGGAGAGGGAAGATGAGGAAGG + Intergenic
1164680552 19:30131189-30131211 AAGGGGAAGGGAGAAGGGGAGGG - Intergenic
1164976522 19:32576998-32577020 AAGGGGAAGGGGAATGGGAAAGG - Intergenic
1165082928 19:33320605-33320627 AAGTAGAAGCCAGATGTGGAAGG + Intergenic
1165636927 19:37348084-37348106 ACGGAGAAGACAAATGAGGAAGG - Intronic
1165716014 19:38046361-38046383 AAGAAATAGGGAAATGAGGAGGG - Intronic
1165910286 19:39221805-39221827 AAGGGGAAGGGAAGGGAGGAAGG - Intergenic
1165934350 19:39380411-39380433 AAGGAGATGGGACATGTACAAGG - Intronic
1165974758 19:39665982-39666004 ATGTGGAAGGGAAATGTGGAAGG - Intergenic
1166034965 19:40161432-40161454 AAGGGGAAGGGAAAGGGAGAGGG + Intergenic
1166422864 19:42652363-42652385 GAAGATGAGGGAAATGTGGACGG - Intronic
1166536664 19:43578933-43578955 AAAGAGAAGGAAAATGTGGGAGG + Intronic
1166548578 19:43649659-43649681 AAGGAGAAGGGAAAGAAGGAAGG + Intronic
1166652136 19:44582660-44582682 AAGGAGAAGGGGAAAGGGAAGGG + Intergenic
1166674944 19:44734651-44734673 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1166730994 19:45058993-45059015 AAAGAGAAGGGAGAGATGGACGG - Intronic
1166738996 19:45102937-45102959 GAGGAGGTGGGAGATGTGGAGGG + Intronic
1167433060 19:49464307-49464329 AGGGAGAAGGGAGATGAAGATGG - Intronic
1167478588 19:49714929-49714951 AATGAGAAGGGATATTTGGTGGG - Intergenic
1167683469 19:50940690-50940712 AAGGAGAAGGGCAAACTGAAGGG - Intergenic
1167684467 19:50947654-50947676 AAGGAAAAGAGAAATCTGGTAGG - Intronic
1167702104 19:51054950-51054972 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1168243801 19:55099990-55100012 AAGGTGAAGGGCAAGGTGGGCGG - Intronic
1168251598 19:55145381-55145403 AGGGAGGAGGGAAAGGGGGAGGG + Intronic
924988147 2:288987-289009 GAGGAGACGGGAGATGGGGAAGG - Intergenic
925064590 2:920521-920543 AAGGAGGAGGGACAGGTGGCAGG - Intergenic
925264606 2:2558191-2558213 ATGGAGAGAGGAAATGTGGCTGG + Intergenic
925294638 2:2768915-2768937 AATGAGAGGGGAGGTGTGGAGGG - Intergenic
925638426 2:5964918-5964940 GTGCAGAAGGGAAATGTGGTGGG - Intergenic
925659158 2:6184141-6184163 AAGGAGAAGAGAAGGGTGGGAGG + Intergenic
925791036 2:7488608-7488630 AAGGAGAAAGGAAGGGAGGAAGG + Intergenic
925791080 2:7488759-7488781 AAGGAGAAAGGAAGGGAGGAAGG + Intergenic
925791094 2:7488805-7488827 AAGGAGAAAGGAAGGGAGGAAGG + Intergenic
925791114 2:7488875-7488897 AAGGAGAAAGGAAGGGAGGAAGG + Intergenic
925791155 2:7489015-7489037 AAGGAGAAAGGAAGGGAGGAAGG + Intergenic
925791186 2:7489123-7489145 AAGGAGAAAGGAAGGGAGGAAGG + Intergenic
925791200 2:7489169-7489191 AAGGAGAAAGGAAGGGAGGAAGG + Intergenic
926236990 2:11053102-11053124 AGGAAGAAGGGAGATGTGGAGGG + Intergenic
926631545 2:15141144-15141166 AAAGAGAAGGGAAAAGGGGATGG - Intergenic
926725482 2:15994233-15994255 AAGGGGAAGGGAAGGGAGGAAGG - Intergenic
927280837 2:21305024-21305046 AAGGAGAAGGGAAGTGGGGAAGG + Intergenic
927287480 2:21371607-21371629 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
927738478 2:25545041-25545063 AAGGAGATGGAAAGTGTGAAAGG - Intronic
927839213 2:26427718-26427740 ACTGAGAAGGGTAGTGTGGAGGG - Intronic
927866174 2:26589147-26589169 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
928122384 2:28592363-28592385 AGGAAGAAGGGAAAGGTGGGAGG - Intronic
928217754 2:29376441-29376463 AAGTAGAATGGAAATGTTAAAGG + Intronic
928229174 2:29481344-29481366 AAATAGAAGAGCAATGTGGAAGG + Intronic
928257409 2:29735146-29735168 AGGGAGAATGGAAATGGGTAAGG + Intronic
928367795 2:30716091-30716113 TAGGAGAAGGGTCATGTGAAAGG - Intergenic
928855409 2:35797039-35797061 AAAGAGGAGGGAAATGCAGAAGG + Intergenic
929091456 2:38221687-38221709 AAAGAGATGGGAAATGTTAATGG + Intergenic
929276900 2:40035435-40035457 AAGGAAAGGGGAGATGTAGAAGG - Intergenic
929407538 2:41659978-41660000 AAAGAGAAAGGAAATGAGAAAGG + Intergenic
929481218 2:42310293-42310315 AAGGGGAAGGGAAAGGGGAATGG - Intronic
929875140 2:45790674-45790696 AAGGAGAAGAAAAACGTGAAGGG - Intronic
930037929 2:47099512-47099534 GAGAAGAATGGAAATCTGGAAGG + Intronic
930053955 2:47237822-47237844 AAGGAGGATGGAAAAGTGGAAGG - Intergenic
930083988 2:47480017-47480039 AGGGAGAAGGGAGAAGGGGAGGG - Intronic
930088555 2:47515728-47515750 AAGAAGGAGGGGGATGTGGAGGG + Intronic
930472104 2:51829824-51829846 AAGGAGAAGAGAAGAGGGGAGGG - Intergenic
930539999 2:52693480-52693502 AGGGAGGAGGGAAAGGAGGAAGG + Intergenic
930729483 2:54713635-54713657 AAGGAGAAGGAAAGTCTAGATGG + Intergenic
930763176 2:55058143-55058165 AAGGAGAGGGAAAAGTTGGAGGG + Intronic
931201688 2:60103650-60103672 AAGGAGAGAGGGAATGTGGTTGG + Intergenic
931512848 2:63019776-63019798 GAGGAGAAGGGAAAGGGGGAGGG + Intronic
931796152 2:65712148-65712170 AAGGGGAAGGGAAAGAAGGAAGG - Intergenic
931940776 2:67249562-67249584 AAGTAGGAGGGAAATGGGGTTGG - Intergenic
932143216 2:69297486-69297508 AAGGAGAAGGAAAATGTGTGTGG - Intergenic
932336658 2:70935672-70935694 AGGGAGAAGGGAAGAGGGGAGGG - Intergenic
932727228 2:74189799-74189821 AAGGAGAGGGGAAAGGAGAAGGG + Intergenic
932793934 2:74679350-74679372 ATGGATTAGGGAAATGTGGGTGG + Intronic
932865139 2:75333882-75333904 GATGAGAAGGCAAATCTGGATGG - Intergenic
932989946 2:76774608-76774630 AAGGAGGAGGAACATGAGGAAGG + Intronic
933167903 2:79095505-79095527 CAGGAGGAGGGAAATGCGGTCGG + Intergenic
933387907 2:81634652-81634674 AAGGAGAAGGAAAAGTGGGAAGG + Intergenic
933853006 2:86385878-86385900 GAGGACAAGAGAAAAGTGGAGGG - Intergenic
934144563 2:89078709-89078731 GAGCAGAAGGGAAATGAGGGAGG - Intergenic
934224689 2:90121840-90121862 GAGCAGAAGGGAAATGAGGGAGG + Intergenic
934566407 2:95344038-95344060 AAGTTGAGGGGCAATGTGGAGGG - Intronic
934873072 2:97885873-97885895 AAGGAGAAGAGAAAGGAGAAAGG - Intronic
935008160 2:99102267-99102289 ATGAAGAAAGGAGATGTGGAGGG + Intronic
935070653 2:99690893-99690915 CAGGAGAAAGGAGATGGGGACGG + Intronic
935446431 2:103161445-103161467 GAGGAGAAGGAAAATATGGAGGG + Intergenic
935489523 2:103699017-103699039 AAGGATAAGAAAAATGGGGAAGG - Intergenic
936241232 2:110790274-110790296 AAGTGGAAGGGAAATCTGGTGGG - Intronic
936445786 2:112594098-112594120 AAGAAGAGTAGAAATGTGGAGGG - Intergenic
937130902 2:119512328-119512350 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
937235812 2:120431337-120431359 CAAGTGAAGGGAAATGTAGATGG + Intergenic
937341660 2:121095306-121095328 GAGCAGAGGGGAAATGTGGTAGG + Intergenic
937552133 2:123107551-123107573 ATGGGGGAGGGAAAAGTGGAAGG - Intergenic
937948492 2:127364750-127364772 AAGATGAGGGGAAAGGTGGAGGG - Intronic
938043410 2:128095377-128095399 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
938677631 2:133654797-133654819 AAGAAGATGGGAAATATGGCAGG - Intergenic
938696066 2:133836756-133836778 AAGGAAAAGGGACATTTGGCAGG - Intergenic
939361598 2:141179630-141179652 AAGGAAAAGGCAAATGTTGAAGG - Intronic
939481528 2:142753989-142754011 ATGGAGAAGGGAAAGGTGTGAGG + Intergenic
939519684 2:143214050-143214072 AAAGAGATAGGAAATGTGAAAGG - Intronic
939861623 2:147427776-147427798 AAGAGGACTGGAAATGTGGAAGG - Intergenic
940101803 2:150048640-150048662 AGGGAGATGGGAGATGTGGAAGG + Intergenic
940163837 2:150745371-150745393 AAGGAGAAGAGCAAAGTTGAAGG + Intergenic
940201028 2:151151029-151151051 AAGGAACAGGGAAAGGAGGATGG - Intergenic
940315115 2:152320246-152320268 AAGGAGAAGGAAAAGTGGGAAGG - Intergenic
941038226 2:160590594-160590616 GAGGAGAAGGGGAAGGGGGAGGG - Intergenic
941156589 2:161986572-161986594 AATTAGAATGGAAATGGGGAAGG + Intergenic
941164445 2:162070571-162070593 AGGGAGAAAGGAAATGTAAAGGG - Intronic
941198745 2:162483010-162483032 AAGGAGAATGGGAATGAAGAAGG + Intronic
941234027 2:162946635-162946657 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
941396232 2:164977166-164977188 AAGAAAAAGAGAAATGTGGTGGG + Intergenic
942123411 2:172800919-172800941 AATGAGGAGGGAAATGGGGTTGG + Intronic
942165731 2:173238998-173239020 ATGGAGGATGCAAATGTGGATGG - Intronic
942183338 2:173401720-173401742 AAGAAGAAGGGAAAGAAGGAAGG - Intergenic
942690604 2:178581090-178581112 AAGAAGAAGGGAAATTAAGATGG + Intronic
943300790 2:186196322-186196344 CAGGTGAAGGGAGATTTGGATGG + Intergenic
943615574 2:190088100-190088122 TGGCAGAAAGGAAATGTGGAAGG + Intronic
943837630 2:192533553-192533575 AAAGAGAAGTGGAATTTGGAAGG - Intergenic
943876307 2:193071915-193071937 CAGAAGAAGGGAAAGGCGGAAGG - Intergenic
943921535 2:193713263-193713285 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
944247924 2:197551352-197551374 AAGGTTAAGGGAAATGAGAAGGG - Exonic
944714014 2:202361095-202361117 AGGGAGAAGGGAGATGGAGATGG - Intergenic
944915953 2:204360373-204360395 TAGGAGGAGAGAAATCTGGAAGG + Intergenic
944925138 2:204456493-204456515 AGGGAGAAGGGAAAGGGAGATGG + Intergenic
945042780 2:205755885-205755907 AGGGTGAAGAGAAAGGTGGATGG + Intronic
945214828 2:207422153-207422175 AAAGAGAAGGGAAGTGGGGTCGG + Intergenic
945890531 2:215426014-215426036 GAGGAGAAATAAAATGTGGAAGG - Intronic
946010493 2:216560143-216560165 AAGGGGAAGGGGAATGGGAAGGG - Intronic
946109626 2:217403189-217403211 GAGGAGAAGGGAGAGGGGGAGGG + Intronic
946346677 2:219116727-219116749 AAGCAGAAAGAAAATGGGGATGG + Intronic
946463663 2:219892192-219892214 AAGAGGAAGGAAAATGAGGAGGG + Intergenic
946566346 2:220970004-220970026 AAGAAGAAGGGAAATAAAGAAGG + Intergenic
946566766 2:220974138-220974160 AAGAAGGAGGGGAATGTGGAGGG + Intergenic
946631314 2:221672185-221672207 AAGGAGAAGTGTAAAGTGAAGGG - Intergenic
946759886 2:222982998-222983020 ATGGAGACGGGAAGTGGGGAAGG - Intergenic
946822727 2:223647097-223647119 AAGTAGAAGGGAAGTGTGAAAGG - Intergenic
947319508 2:228900569-228900591 AAGAAGAAGCCAAATGTGCAAGG + Intronic
947442299 2:230133826-230133848 GTGCAGAAGGGAAATGTGGGTGG - Intergenic
947624825 2:231612913-231612935 AGGGAGAAGGGAAGGGGGGACGG + Intergenic
947924133 2:233906134-233906156 AAGGAGAAGGTAAATATGAGAGG + Intergenic
948036977 2:234865656-234865678 TAGGAGAAGAGTAATGTGGTTGG - Intergenic
948100242 2:235367227-235367249 AAAGAGCAGGGGAATGTGGTGGG - Intergenic
948173290 2:235923856-235923878 AAGGAGAAGAGAAATCTTAAAGG + Intronic
948344339 2:237282679-237282701 AAGGAGAAGGGGAAGGGGGAGGG + Intergenic
948558565 2:238835263-238835285 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
948558591 2:238835344-238835366 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1168957761 20:1846490-1846512 AATGGGAAGGAAAAAGTGGATGG + Intergenic
1169067472 20:2702063-2702085 AGGGAGCAGGGAAAGATGGAGGG + Intronic
1169178632 20:3542580-3542602 AAGGGGAAGGGAGAAGGGGAAGG - Intronic
1169178644 20:3542606-3542628 AAGGAAAAGGGGAAGGGGGAAGG - Intronic
1169235385 20:3926051-3926073 ATGGAGAGGGGAGAAGTGGATGG + Intronic
1169572992 20:6926858-6926880 AAGGAGACAGGGAATGTAGAGGG + Intergenic
1169823550 20:9741263-9741285 AAGAAGAAGGGAAATAAGAAGGG + Intronic
1170421561 20:16198581-16198603 GAGGAGTAGGGAAATGAAGAGGG - Intergenic
1170529913 20:17281004-17281026 AAGGAGAAGGCAAATATGGCGGG - Intronic
1170579241 20:17685250-17685272 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1170797156 20:19558059-19558081 ATGGGGGAGGGAAATGAGGATGG + Intronic
1170950300 20:20930690-20930712 AAGTAGCAGGTAAATGGGGAAGG - Intergenic
1171077036 20:22137838-22137860 GTGCAGAAGGGAAATGTGGATGG - Intergenic
1171183911 20:23111387-23111409 CAGGGGAAGGGAGATGGGGAAGG + Intergenic
1171297641 20:24032766-24032788 AGGAAGAAAGGAAAGGTGGAAGG - Intergenic
1171815604 20:29783542-29783564 AGGGAGAAGGGATTAGTGGAGGG - Intergenic
1172125953 20:32625407-32625429 AGGAAGGAGGGAAAGGTGGAGGG + Intergenic
1172144163 20:32744433-32744455 CTGGAGCAGGGAAATGTGGGGGG + Intergenic
1172891398 20:38268475-38268497 AAGGAGAGGGGGAATGAAGAAGG - Intronic
1173180279 20:40801371-40801393 AAGGAGAAGGAGGATTTGGATGG + Intergenic
1173581442 20:44149548-44149570 GAGCAGCAGGGAAATGGGGAGGG - Intronic
1174004305 20:47398255-47398277 AAGGAGAAGGGAAAGGAAGAGGG + Intergenic
1174379788 20:50149260-50149282 AGGGGGAAGGGAAAGGTGGAGGG - Intronic
1174950306 20:55035236-55035258 AAGCAGAAGGTGATTGTGGAAGG + Intergenic
1174959262 20:55136597-55136619 AAGGCAAATGGAAATGTGGTAGG - Intergenic
1175223284 20:57430013-57430035 AACGAGAAGTGAGAAGTGGAGGG + Intergenic
1175239174 20:57533994-57534016 GAGGAGAAGGGCACCGTGGAAGG - Intergenic
1175287694 20:57848717-57848739 AGGGAGAAAGGAAATGAGGAAGG - Intergenic
1175533805 20:59693280-59693302 GAAGAGAAGGGAGATGGGGACGG - Intronic
1175565007 20:59967737-59967759 AAGGGGAAGGGAAGGGAGGAAGG - Intronic
1175594682 20:60221682-60221704 AGGTTGAAGGGAATTGTGGAAGG + Intergenic
1175763345 20:61576034-61576056 AAGGAGAAGGGACAAGTGGAGGG + Intronic
1176275597 20:64265707-64265729 AAGGAGAAGGGGAAGGAAGAGGG - Intronic
1176939071 21:14901884-14901906 AAGAAGAAGTGAAATTTGAAGGG + Intergenic
1177046991 21:16183157-16183179 AAGTGGAAGGTAAAAGTGGAAGG - Intergenic
1177114869 21:17073355-17073377 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1177115126 21:17075821-17075843 TTGGAGAAGGGAAATGAGCATGG + Intergenic
1177432680 21:21010944-21010966 AAGGGGAATGGGAATGTGGGTGG + Intronic
1178150830 21:29791495-29791517 AAGGAGAAGGGAAGTGGGGGGGG + Intronic
1178462797 21:32818327-32818349 AAGGGGAAGGGAAGTTGGGAAGG - Intergenic
1178605473 21:34032988-34033010 AAGGAGAAGGTAGCAGTGGAGGG - Intergenic
1178637722 21:34319578-34319600 AAGGAGAATGGATATGGGGAAGG + Intergenic
1178857221 21:36260225-36260247 AAGGGGAAGGGAAGGGAGGAAGG + Intronic
1179186194 21:39086945-39086967 AAGGAGAAATGAAATGAGAAGGG + Intergenic
1180060604 21:45383109-45383131 AAGGAGACGGGAGAGGAGGATGG + Intergenic
1180164834 21:46019686-46019708 AAGGAGATGGGAAAGGAGGTGGG - Intergenic
1180590166 22:16930604-16930626 AAGGGCAAGGGGAGTGTGGATGG + Intergenic
1181314652 22:21963567-21963589 CAGGAGAAGGCAAATGAGGAAGG - Intronic
1181389803 22:22571959-22571981 AAGGGGAAGGGAAGGGAGGAAGG + Intergenic
1181776101 22:25161113-25161135 AAGGAGAAGGAAAGTTAGGAAGG - Intronic
1181789213 22:25250488-25250510 AAGGAGAAGGGAAGGGAGGGAGG - Intergenic
1181876831 22:25946077-25946099 AATGAGAAGGGAAGAGGGGAAGG - Intronic
1181885314 22:26017386-26017408 AAAGAGAAGGGAGAGGAGGAAGG - Intronic
1182083220 22:27543652-27543674 AAGGAGGAGGGAAGGGAGGAGGG - Intergenic
1182177757 22:28309883-28309905 AAGAAGAAGAGAAATGTACAGGG + Intronic
1182353595 22:29712254-29712276 AAAGAGAAGGGAAAGAAGGAAGG + Intergenic
1182408347 22:30158566-30158588 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
1182413246 22:30204670-30204692 AATGAGAAGGGAACTGTGGTTGG + Intergenic
1182459958 22:30476503-30476525 AAGGGGAGGGGAGATGGGGAAGG - Intergenic
1182474799 22:30571203-30571225 AAGGAGCTGGGAAGTGTGGGTGG + Intronic
1182497376 22:30719188-30719210 AAAGAGAAGGGGAGTGAGGAGGG - Intronic
1182650783 22:31849444-31849466 AAGGAGAAGTGCAGAGTGGAGGG + Intronic
1182853041 22:33492884-33492906 AGGGAGGAGGGAAATGCGGGCGG + Intronic
1183153153 22:36053724-36053746 AAGGAGAAGGGAAGGGAGAAGGG - Intergenic
1183153157 22:36053736-36053758 AGGGAGAAGGGAAAGGAGAAGGG - Intergenic
1183153172 22:36053779-36053801 AGGGAGAAGGGAAGGGAGGAGGG - Intergenic
1183153185 22:36053810-36053832 AGGGAGAAGGGAAGGGAGGAGGG - Intergenic
1183159925 22:36106049-36106071 AAGGAGAGGAGAAAAGTGGCAGG - Intergenic
1183266193 22:36827327-36827349 AAGGAGGAAGGAAAGGGGGAGGG - Intergenic
1183309348 22:37101092-37101114 AAGGAGCAGAGAAATGGGGGAGG + Intronic
1183796296 22:40121206-40121228 AGGGAGGAGGGAAAGGAGGAAGG - Intronic
1183868831 22:40725226-40725248 AAGGAGAAGGAAGATGAGGGTGG - Intergenic
1184149228 22:42628845-42628867 ATGGAGAAGGGGAAGGTGGCTGG + Intronic
1184642510 22:45879920-45879942 AACCAGAAGAGAAATGTGGCAGG - Intergenic
1184670986 22:46012278-46012300 AAGGAGAAAGGAGATAAGGATGG + Intergenic
1184976224 22:48064302-48064324 AAGGCTAAGGCAAGTGTGGATGG + Intergenic
1184984030 22:48117284-48117306 AAGGAGAAGGGAAATGAAGGAGG + Intergenic
1184987265 22:48144410-48144432 TGAGAGAAGGGAGATGTGGAGGG + Intergenic
1185114458 22:48923689-48923711 GAGTAGAATGGAAAGGTGGAGGG + Intergenic
1185129625 22:49031808-49031830 AGGGAGGAAGGAAAAGTGGAGGG - Intergenic
1185398208 22:50603352-50603374 GAGGAGGAGGGAGATGGGGAAGG + Exonic
949194886 3:1293237-1293259 AAGGAGAAAGAAAATGTGGAAGG - Intronic
949698811 3:6731635-6731657 CAGGTGAAGGGAAAAGTGCATGG + Intergenic
950105672 3:10386781-10386803 AGGAAGATGGGGAATGTGGAAGG - Intronic
950141727 3:10620503-10620525 CAGGAGTAGGGAAACCTGGAAGG + Intronic
950360811 3:12448305-12448327 AAGGAGAAGGGAAGGAAGGAAGG + Intergenic
950802109 3:15561179-15561201 AAGGAGAAGGGAGATGAAGGAGG + Intronic
951150107 3:19278479-19278501 AGGAAGGAGGGAAATGAGGAAGG + Intronic
951258625 3:20481023-20481045 ATGCAGAAGGGAAATGTAGTCGG + Intergenic
951264581 3:20551248-20551270 AAAGAGAAGGGAAATTGGAAAGG - Intergenic
951451236 3:22841134-22841156 AGGGAGAAGTGAAATCTAGAGGG + Intergenic
951482976 3:23181343-23181365 TAGTAAAAGGGAAAAGTGGAAGG - Intergenic
952046488 3:29327486-29327508 AAGGAGGAGGAAAAGGAGGAAGG - Intronic
952336964 3:32411919-32411941 AGGCAGGAGGGAAAGGTGGAAGG + Intronic
952505753 3:34005551-34005573 AAGTGGTGGGGAAATGTGGATGG + Intergenic
952781879 3:37108589-37108611 GAAGAGGAGGGAAATGTGGGTGG - Intronic
953160439 3:40414782-40414804 AAGAAGAAGGGGTATATGGATGG + Exonic
953518911 3:43622436-43622458 ATGGAAGAGGGAAATGTGAAGGG - Intronic
953736262 3:45496559-45496581 AAGGAGAAGGGAAAGGAAGGAGG + Intronic
953757671 3:45661145-45661167 ATGGAGTAGGGGAATGTGGGTGG - Intronic
953830529 3:46294038-46294060 AAGGATTAGTGAGATGTGGATGG + Intergenic
954151149 3:48657751-48657773 GGGGAGAAGGGAAAGGTGGCTGG - Intronic
954154431 3:48677463-48677485 AAGGGGAAGAGAAAAATGGAAGG - Intronic
954377433 3:50202519-50202541 GAGGGGAAGGGCACTGTGGATGG - Intergenic
954505459 3:51067525-51067547 AGGGAGAAGGGAAGTGGGGAGGG - Intronic
954699781 3:52445199-52445221 AAGGAGAAGCGGCAGGTGGACGG - Intergenic
954970443 3:54647303-54647325 AAGGAGAAGGGAGAAAGGGAAGG + Intronic
955050889 3:55409812-55409834 AAGGAGAGGGGATGTGGGGAGGG + Intergenic
955150686 3:56363869-56363891 AAGGGAAAGGGAAAGGGGGAGGG + Intronic
956392732 3:68790936-68790958 AAGGATAAGGCAAACGTGGATGG + Intronic
956465047 3:69511731-69511753 AAGGAGAAGGGGAAGGAAGAAGG - Intronic
956510270 3:69985658-69985680 AGGGAGAAGGGATGTGGGGAGGG + Intergenic
956642103 3:71424943-71424965 TAGGAAGAGGGAAATGTGTATGG + Intronic
956660196 3:71589899-71589921 TATGAGAAGGGAAATGAGGCAGG + Intergenic
957328501 3:78728208-78728230 GAGGAGAAGGAAAAGGAGGAAGG + Intronic
957416912 3:79917373-79917395 AAGGAAAAAGGAAGTGAGGAAGG + Intergenic
957467496 3:80613288-80613310 AAGAGGAAGGGAAAAGGGGAAGG + Intergenic
957640763 3:82850316-82850338 AAGGAAAAGGGGAAGGTGAAGGG - Intergenic
958039714 3:88212128-88212150 AAGAAGAAGTCAAATCTGGAAGG - Intergenic
958087236 3:88825975-88825997 AAGGAGAAAGGAAAGAAGGAAGG - Intergenic
958709897 3:97705255-97705277 GAGGGGATGGGAAATGTGGGAGG - Intronic
959240909 3:103792500-103792522 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
959338786 3:105100933-105100955 AAGTAGAAGAAAAATGTTGATGG - Intergenic
959369061 3:105500275-105500297 AAGGAGATGAGAAAAGAGGAAGG - Intronic
959731432 3:109607771-109607793 AAGAAGAGTGGAAATGTGAATGG + Intergenic
959751504 3:109841970-109841992 AAGGAGAAGGGAATTGGAGTGGG + Intergenic
959760896 3:109963698-109963720 TAGGAGATGGGACATTTGGAAGG - Intergenic
959818516 3:110704172-110704194 AGGCAGAAAGGAAATGTGGGTGG - Intergenic
960607011 3:119516783-119516805 TAGGAGACAGGAAATGTGGAGGG - Intronic
961097716 3:124172233-124172255 AAGGCGAAGGGGAATGGGGTAGG - Intronic
961221922 3:125207930-125207952 AAGGAGATGCCATATGTGGAAGG - Intronic
961485757 3:127214680-127214702 AAGGAGAGGAGAAAGGTGGGGGG + Intergenic
961724408 3:128916772-128916794 AATGAAAATAGAAATGTGGAAGG + Intronic
962040733 3:131705063-131705085 AGGAAGAAGGGAAAAGTGGGTGG - Intronic
962188963 3:133290144-133290166 TAGGGGATAGGAAATGTGGAGGG + Intronic
962338413 3:134559800-134559822 AAGGAGAAAGGGAGTGTGGAGGG + Intronic
962865177 3:139442526-139442548 AAGGAGCAGGGAAAGGTCTAGGG + Intergenic
963607866 3:147427792-147427814 AAGGGGAAGGGAACAGGGGATGG - Intronic
963914939 3:150850421-150850443 AAGGAGAAGTGCAAAGTGAATGG - Intergenic
964028308 3:152105045-152105067 AATGAGAATGGAAAAGAGGAAGG - Intergenic
964219708 3:154329189-154329211 AAGTAGAATGAAAAGGTGGAAGG + Intergenic
964507317 3:157413613-157413635 AAGTAGCAGGGTTATGTGGAAGG - Intronic
964833332 3:160910251-160910273 AAGGGGAAGGGGAAAGGGGAAGG - Intronic
965044361 3:163556344-163556366 AAGAAGAAGAGAAAGTTGGAGGG + Intergenic
965392148 3:168118026-168118048 AAGAAGACAGGAAATGGGGAAGG + Intergenic
965410746 3:168327424-168327446 AAGGAGAAGAAAAACGTGTAGGG - Intergenic
965551656 3:169971902-169971924 CAACAGAAAGGAAATGTGGAAGG - Intronic
965697876 3:171428181-171428203 AAGGAGAAGGGAGATGAGTTCGG + Intronic
965743506 3:171901275-171901297 AATGAGGTTGGAAATGTGGATGG + Intronic
965888099 3:173474129-173474151 AAGGAAAAGGAAAAGGAGGAGGG - Intronic
966266225 3:178047721-178047743 AAGGAGAAAGGAAAGGAGGAAGG + Intergenic
966491141 3:180529776-180529798 AAAGAGAAGGGAAGAGTGGGAGG + Intergenic
966574530 3:181484777-181484799 CAGGATGAGGGCAATGTGGATGG + Intergenic
966767405 3:183475674-183475696 AAGGAGAAGAAAAATGTAGATGG + Intergenic
966861601 3:184233676-184233698 AAGGAGAAGGTATATGGGGCAGG - Exonic
966897655 3:184457729-184457751 AAGGGGAAGGGGAAATTGGAGGG + Intronic
967312651 3:188120735-188120757 AAGGAGAGAGCAAAAGTGGAAGG + Intergenic
967365483 3:188681660-188681682 AAGGAGAAGGAAAAGGAGGGAGG + Intronic
967489017 3:190067295-190067317 AAGGAGAAGGAAGAAGTGGGAGG + Intronic
967788670 3:193523985-193524007 AAGCAGAAGGGAAGTGGGCATGG - Intronic
968135629 3:196217639-196217661 AAGGAGAAGGGGAAGGGGAAGGG + Intronic
968420035 4:476198-476220 AAGGAGAAGGGTTTTCTGGAAGG - Intronic
968424614 4:514185-514207 AAGGAGAAGGGAAATGAGTGTGG - Intronic
968857509 4:3138155-3138177 AAGGGGAAGGGAAAAGGGGAAGG - Intronic
968907290 4:3460372-3460394 AAGGCAAAGGGAAATGGTGAAGG + Intergenic
969373730 4:6749805-6749827 AATGAGAAGGGAAAGGAGAAAGG - Intergenic
969397674 4:6933272-6933294 AAGGGGAAGGGGAAGGGGGAGGG - Intronic
969668553 4:8576139-8576161 GAGGAGGGAGGAAATGTGGAGGG - Intronic
969954804 4:10877995-10878017 AAGGAGGAGGAAAAGGAGGAAGG - Intergenic
970122063 4:12765921-12765943 AAGTAGAGGGGAAATATGGAAGG - Intergenic
970139231 4:12962426-12962448 AAGGGGAAGGGAGATGATGATGG - Intergenic
970213832 4:13738094-13738116 AAGGTGATGGGAAGAGTGGATGG + Intergenic
970302519 4:14696419-14696441 AAGGAGAAAGGGAAGGAGGAAGG + Intergenic
970645303 4:18113844-18113866 AAGGGGAAGGGAAAGGGGAAGGG + Intergenic
970966524 4:21934685-21934707 AAGGACAGGGGAAGAGTGGAGGG - Intronic
971305120 4:25473301-25473323 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
971353620 4:25874504-25874526 AAGCAGAAGGAAAATAAGGAGGG + Intronic
971397207 4:26239713-26239735 AAGGAGAAGAGAAGAGGGGAGGG + Intronic
971399322 4:26261429-26261451 AAGTAGAAAAGAAATGAGGAAGG + Intronic
971415624 4:26425694-26425716 AAGGAGAGGGAAAATTGGGAGGG - Intronic
971445493 4:26742065-26742087 GAGGGGAAGGGACATATGGAGGG + Intronic
971636645 4:29068717-29068739 AGGGAGAAGGGGAAAGGGGAGGG - Intergenic
971688682 4:29804827-29804849 AAAGGGAAGGGAAAAGGGGAGGG - Intergenic
972004230 4:34078609-34078631 AAAGAGAAGGACTATGTGGATGG + Intergenic
972479279 4:39482666-39482688 AAGGAAAAAGGAAAAGAGGAAGG - Intergenic
972492289 4:39599276-39599298 AAGGAGAAGAGTAGGGTGGAAGG + Intronic
972868112 4:43259506-43259528 AAAGAGGAGAGAAATGAGGATGG - Intergenic
973219924 4:47713718-47713740 AAATAGATTGGAAATGTGGAGGG - Intronic
973655607 4:53044575-53044597 AAAGAGAAGGGGAATGGGAAGGG - Intronic
974201066 4:58641279-58641301 AAGGAGATGAGAAAGGTGTATGG - Intergenic
974214948 4:58832979-58833001 AAGGGGAAGGGAAAGGGGAAGGG - Intergenic
974214953 4:58832991-58833013 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
974753777 4:66176796-66176818 AAGGAGAAGGGAAAGGGAGAGGG + Intergenic
974941253 4:68471301-68471323 AAGGAGAAGGGAAAGGAAAAAGG - Intronic
975100673 4:70509397-70509419 AAGGAGAAGAGATCTGAGGAGGG + Intergenic
975360210 4:73460925-73460947 AAGGAGGAGGGGAAGGGGGAGGG - Intergenic
975362362 4:73485704-73485726 AAGGAGAAGGGGAAGGGGAAGGG + Intronic
975553376 4:75635962-75635984 GAGGAGAAGTGGATTGTGGAGGG - Intergenic
975654674 4:76629625-76629647 AGGGAGATGGGAGATGTGGTTGG + Intronic
975757006 4:77580830-77580852 AGGGAGAGGGGAAAGGAGGAGGG - Intronic
975887838 4:78986246-78986268 TAGGAGAAGTGAGAAGTGGAGGG - Intergenic
975984556 4:80190301-80190323 AAGAACATGGGAAATGTGGCGGG + Intronic
976096419 4:81513081-81513103 AAGAGGAAGGGAAAGGGGGAGGG - Intronic
976222650 4:82770338-82770360 AAAGAGAAGGGAGATGGGAAAGG - Intronic
976359496 4:84160945-84160967 AAGAAGAAGGAAGATGAGGAAGG - Intergenic
976615273 4:87069631-87069653 AAGGAGAAGAGAAAAAAGGAAGG - Intronic
977728070 4:100320798-100320820 AAGGAGAAGGGAAGGGAGGAAGG - Intergenic
977868385 4:102059127-102059149 AAGGATTTGGGAAATGGGGAGGG - Intronic
978014904 4:103731530-103731552 AATGAGAAGGGAAATGAGAAGGG + Intergenic
978875337 4:113634160-113634182 AAGGAACAGGGAAACCTGGAAGG - Intronic
979123029 4:116926833-116926855 AATGAGCAGAGGAATGTGGATGG + Intergenic
979367020 4:119837429-119837451 AAGGAGAAGGGGATGGGGGAGGG + Intergenic
980019328 4:127689733-127689755 AAGGGGAAAGGAAAGGGGGAGGG + Intronic
980176745 4:129355123-129355145 AAGCAGAAGGGAAAAATGCAGGG + Intergenic
980208695 4:129756394-129756416 AAGGAGGAGGGAAAGGTGGGTGG - Intergenic
981220231 4:142223436-142223458 ATGGAGGAGGGAAAAGTGTATGG - Intronic
981308102 4:143267934-143267956 ATGGGGAAGAGAAATGTGGTTGG + Intergenic
981355827 4:143788022-143788044 AAAGAGAAGGGAATAGTGGAAGG + Intergenic
981363266 4:143871796-143871818 AAGGGAAAGGGAATTGTGGTTGG + Exonic
981367364 4:143918679-143918701 AAAGAGAAGAGAATAGTGGAAGG + Intergenic
981374001 4:143992597-143992619 TAGGGGAAGGGAATTGTGGTTGG + Intergenic
981377150 4:144028913-144028935 AAAGAGAAGGGAATAGTGGAAGG + Intergenic
981430235 4:144648759-144648781 GAGGAGAAGGGGAAGGGGGATGG + Intronic
981550066 4:145935044-145935066 GAGGAGAAGGGAGATCTTGAAGG - Intronic
981820683 4:148883665-148883687 AATGAGAAGAGATATGTGAATGG + Intergenic
981876694 4:149555104-149555126 AAGGAGAAAGGAGAAGAGGAGGG - Intergenic
981918100 4:150056896-150056918 AAAGAGGAGGAAAATGTGGAGGG - Intergenic
981950707 4:150403549-150403571 AAGGAGAAGGGAAAGGAGAAGGG - Intronic
982169093 4:152643946-152643968 GAGGAGAAGGGAAGAGTGGGAGG - Intronic
982175920 4:152705483-152705505 GAGGAGCAGGGAGAAGTGGAGGG - Intronic
982418782 4:155168937-155168959 TAGGAGAAGGGAGATTTGGAAGG - Intergenic
982905408 4:161063147-161063169 AAGGAGAGGGTAAAAGAGGAAGG - Intergenic
982935819 4:161474010-161474032 AATGAGAGGGGAAATCTGTAAGG - Intronic
982959169 4:161814102-161814124 AAGGGGAAGAGAAAGATGGAAGG + Intronic
983006771 4:162493525-162493547 GTATAGAAGGGAAATGTGGATGG + Intergenic
983023471 4:162708502-162708524 AAGGAGATTGTAAATGTTGATGG - Intergenic
983131746 4:164028572-164028594 AAGGGGTAGGGAAACGAGGAGGG + Intronic
983487988 4:168353832-168353854 CAGGGTAGGGGAAATGTGGATGG + Intergenic
983552552 4:169032394-169032416 AAGGAGAAAGGAAGGGAGGAAGG - Intergenic
983611794 4:169654238-169654260 AGGAAGAAGGGAAAGGAGGAGGG - Intronic
983665105 4:170172607-170172629 AAGCAGAAGGGAACTTTTGAAGG - Intergenic
984070309 4:175103264-175103286 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
984725159 4:183013444-183013466 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
984911437 4:184676929-184676951 AGGGAGAAGGGGAAGGGGGAAGG - Intronic
984951271 4:185009490-185009512 AGGGAGAAGGCAAGTGAGGATGG + Intergenic
985003504 4:185509404-185509426 AAGGAAAAGGGAAATATGCCTGG - Intronic
985331442 4:188841151-188841173 ATGGAAAAGAGAGATGTGGAGGG + Intergenic
985552725 5:541619-541641 GAGGAGCAGGGGAAGGTGGAGGG - Intergenic
985870894 5:2555980-2556002 AATGAGAATGGAAGTGTGAATGG - Intergenic
985913467 5:2900590-2900612 GTGGAGAAGGGGAAGGTGGAAGG - Intergenic
986001147 5:3631795-3631817 AAGGAGAAGGGAAGGAAGGAAGG - Intergenic
986022973 5:3821998-3822020 ATGGAGGAGGGCATTGTGGAGGG + Intergenic
986355094 5:6916025-6916047 AAAGAGAAGGGTAATGTTCAAGG + Intergenic
986433614 5:7705755-7705777 AAGAGGAAAGGAAATGGGGAAGG + Intronic
986468366 5:8049962-8049984 AAGGAGAAGGGAAGGAAGGAAGG + Intergenic
986468443 5:8050296-8050318 AAGGAGAAGGGAAGGAAGGAGGG + Intergenic
986566759 5:9123416-9123438 AAGAAGAAGGAAAAGGAGGAGGG + Intronic
986662009 5:10067589-10067611 AAAGAGAAGGGAACCGTGGCTGG + Intergenic
986723453 5:10577098-10577120 AAGGGGAAGGGAAAGGGGAAGGG - Intronic
986814573 5:11394398-11394420 AAGAAGAAGGGGTCTGTGGAGGG + Intronic
986946611 5:13029152-13029174 AAGGGGAAGGGAAAAGCGAAGGG + Intergenic
987190883 5:15477198-15477220 AGGGAGAAGGAAAATGGGGAGGG - Intergenic
987551404 5:19386650-19386672 AAGGAGGAGGGAGAAATGGAGGG + Intergenic
987954883 5:24726401-24726423 AAGCTGAAGGGAAGGGTGGAAGG + Intergenic
987986625 5:25155290-25155312 ACAAAGAAGGGACATGTGGATGG + Intergenic
988089626 5:26519794-26519816 AAGGAGAAGGAAAAAGAAGAAGG + Intergenic
988106075 5:26750156-26750178 AAGGAGAAGAAAAAAGAGGAGGG - Intergenic
988382512 5:30516210-30516232 AATAAGAATGGAAATGTGGGAGG + Intergenic
988395201 5:30688287-30688309 AAGGAGAGTAGAAATGTGAAAGG - Intergenic
988417924 5:30969658-30969680 AAGGAGAAAGAAAAAGTAGATGG + Intergenic
988458549 5:31411048-31411070 AAGGAGAAGGTAAATGGGCATGG - Intronic
988475691 5:31583296-31583318 AAGGAAAAAGGAAAGGAGGAAGG + Intergenic
988718144 5:33848066-33848088 AAGGAGCAGGGCATTGTGGCAGG + Intronic
988845329 5:35121822-35121844 AAGCAGAATGGAATTGTGGTTGG - Intronic
988883350 5:35529495-35529517 AATGAGAAGGGAAAAGTGGAAGG - Intergenic
989367013 5:40667479-40667501 AAAGAAAAGGGAAAGGAGGAAGG - Intergenic
989543006 5:42639940-42639962 TTGAAGAAGGGAAGTGTGGAGGG + Intronic
989654620 5:43733135-43733157 AAGGAGAAGGAAAAAGTGGTGGG - Intergenic
989690032 5:44131129-44131151 AAGGAGAAGGGCAGAGTGAATGG - Intergenic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990756707 5:59079877-59079899 GAGGAGAAGGGGAATGGGCAGGG + Intronic
990786294 5:59424127-59424149 AAGGACATGGGAGATGGGGAAGG + Intronic
991083088 5:62621957-62621979 AAGGAGAAAGGAAACCTGAAAGG + Intronic
991646662 5:68807949-68807971 AAGGGGAAGGGAAAAGGGGAAGG + Intergenic
992482210 5:77163282-77163304 AAAGACAAAAGAAATGTGGAGGG - Intergenic
992669219 5:79042185-79042207 ATGCAAAAGGGAAATGTGGGAGG - Intronic
992697467 5:79304213-79304235 AAGGAGTAGTGAAATAAGGAAGG + Intronic
992740809 5:79771612-79771634 AAGGAGAAGGGATGGGGGGATGG + Intronic
993015372 5:82529828-82529850 AATCACAAGGGAAATGAGGAAGG - Intergenic
993095024 5:83471654-83471676 AAGGAGGAGGGAGAGGAGGAGGG - Exonic
993193761 5:84713156-84713178 AAGAAGAAGTGAAAAGTAGAAGG - Intergenic
994030530 5:95136542-95136564 AAGGGGGAGGGAAGTGGGGAAGG + Intronic
994064200 5:95517487-95517509 AAGGAGAAAGGGAAGGAGGAAGG + Intronic
994253320 5:97563074-97563096 AAGGAAAAGGGATATGGAGAAGG + Intergenic
994302724 5:98165096-98165118 AAGGGGAAGGGAAAAGGGAAAGG - Intergenic
994604968 5:101955509-101955531 AAGGTGAAGGGAAATCAGAATGG - Intergenic
994867220 5:105290921-105290943 ATGGAGAAAAGAAATGTAGATGG - Intergenic
995153478 5:108880229-108880251 GAGAATAAGGGAAATGTGCAGGG + Intronic
995558121 5:113351557-113351579 AAGTAGAGGGGAAGTGGGGATGG + Intronic
995592066 5:113709589-113709611 AAGGAAAAGAGAAATGTGTGTGG - Intergenic
995667477 5:114559386-114559408 AATGAGAAGGGGCATGAGGAGGG + Intergenic
995882448 5:116858269-116858291 AAGGGGAAGGGAAAGGGGAAGGG - Intergenic
995958195 5:117806163-117806185 AAGGAAAAGGGAAGAGAGGAGGG - Intergenic
996137483 5:119861856-119861878 TATGAAAAGGAAAATGTGGAAGG + Intergenic
996235678 5:121126961-121126983 AAGGAGGAGGGCAAAGGGGAAGG - Intergenic
997028672 5:130096826-130096848 AAGGAGGAGGAGAATCTGGAAGG + Intronic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997465699 5:134086695-134086717 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
997673733 5:135696868-135696890 AAGGAGCAGGGAGATGGGGCTGG + Intergenic
997727527 5:136133713-136133735 GAGGAGAGGGGAAAAGGGGAGGG - Intronic
997747412 5:136311229-136311251 AAGGAGGAGGGAATGGTGTAGGG + Intronic
997854213 5:137358534-137358556 AAGGAAGAGGGGAAGGTGGAGGG + Intronic
998394727 5:141811468-141811490 AATGAAAAGGGGAATGAGGAAGG - Intergenic
998484086 5:142486597-142486619 GAGGAGGAGGGAAAGGAGGAAGG - Intergenic
998565189 5:143210556-143210578 AAAGAAAAGGGAAATACGGAGGG - Intronic
998705532 5:144755353-144755375 AATGTGAATGGAAATGTGAATGG - Intergenic
999070087 5:148735593-148735615 GAAGGAAAGGGAAATGTGGATGG - Intergenic
999241750 5:150131943-150131965 AAGGAGCAGGGACATGGCGAGGG + Intronic
999296537 5:150462959-150462981 AGGGAGAAGGGAGATGAGGTGGG + Intergenic
999751713 5:154632358-154632380 AGGGAGAAGGGAAAGAAGGAAGG - Intergenic
999859084 5:155625911-155625933 GAGGAGGAAGGAGATGTGGAAGG - Intergenic
999860494 5:155640510-155640532 AAGGGGAAGAGAAAAGAGGAAGG - Intergenic
1000015638 5:157273276-157273298 AAAGAGAAGGGACTTGTGCAAGG - Intronic
1000101599 5:158022215-158022237 AAGGTGAAGGGAAAGGCGAAGGG - Intergenic
1000113852 5:158135158-158135180 CAGGAGAAAGGAGATGGGGAAGG + Intergenic
1000871910 5:166587792-166587814 AAGGAAAAAAGAACTGTGGAAGG + Intergenic
1000893874 5:166831383-166831405 AATCTAAAGGGAAATGTGGATGG + Intergenic
1001415228 5:171540948-171540970 AAGGAGAAAGGAAAGAAGGAAGG + Intergenic
1001685303 5:173590238-173590260 AAGGAAAAGAGAAAAGAGGAAGG + Intergenic
1002359540 5:178659804-178659826 AAGGAGAAGAGAAAAGTACAGGG + Intergenic
1002553398 5:180015447-180015469 AAGGAGTAGGGAAAGGAGTAGGG + Intronic
1002553401 5:180015459-180015481 AAGGAGTAGGGAAAGGAGTAGGG + Intronic
1002553426 5:180015563-180015585 AAGGAGTAGGGAAAGGAGTAGGG + Intronic
1002553429 5:180015575-180015597 AAGGAGTAGGGAAAGGAGTAGGG + Intronic
1002553432 5:180015587-180015609 AAGGAGTAGGGAAAGGAGTAGGG + Intronic
1002553435 5:180015599-180015621 AAGGAGTAGGGAAAGGAGTAGGG + Intronic
1002553438 5:180015611-180015633 AAGGAGTAGGGAAAGGAGTAGGG + Intronic
1002553441 5:180015623-180015645 AAGGAGTAGGGAAAGGAGTAGGG + Intronic
1002553456 5:180015692-180015714 AAGGAGTAGGGAAAGGAGTAGGG + Intronic
1002553468 5:180015750-180015772 AAGGAGTAGGGAAAGGAGTAGGG + Intronic
1003403361 6:5809088-5809110 AAGGAGAAGGGGAAAAAGGAAGG - Intergenic
1003872783 6:10415125-10415147 AAGGAGGAGGGAGAGGAGGAGGG + Exonic
1004131175 6:12921531-12921553 AGGGAGGAGGGAAAGGAGGAAGG + Intronic
1004294458 6:14397563-14397585 GAGGAGAAGGCAATTGAGGAAGG - Intergenic
1004342495 6:14819655-14819677 GAGTAGAAGGGAAAAGTGGGAGG - Intergenic
1004704465 6:18111216-18111238 AAGGAGCTAGGAACTGTGGAAGG + Intergenic
1005377582 6:25199726-25199748 AAGGAGAAGGCACATGAGCAAGG - Intergenic
1005509224 6:26497398-26497420 TAAGAGAAGTGAAATGAGGAAGG + Intergenic
1005810529 6:29511987-29512009 AAGGAGAAGGGCAGAGTGAAAGG + Intergenic
1006000183 6:30958525-30958547 AAGGAGAAGGAAAAACTGGAAGG - Intergenic
1006119261 6:31794412-31794434 AAAGAGAAATGAAATGAGGAAGG - Intronic
1006223878 6:32519653-32519675 TAGGAGAAAGGAAATGTAGAGGG + Intronic
1006562976 6:34929777-34929799 AAGGAAAAGGGGAAGGGGGAGGG - Intronic
1006562981 6:34929784-34929806 AAGGAGGAAGGAAAAGGGGAAGG - Intronic
1006567766 6:34974211-34974233 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
1006810647 6:36818296-36818318 GACGAGAAGGGAAGTATGGATGG - Intronic
1006813777 6:36837725-36837747 AAGGAAGAGTGAAATCTGGATGG + Intronic
1007376690 6:41461831-41461853 AAGCAGGAGGGAAATGGGCATGG + Intergenic
1007431882 6:41781185-41781207 AGGGGGAAGGGAATTATGGAAGG + Intronic
1007446149 6:41907641-41907663 AAAGAGAAGGAAAATGTGTGTGG + Intronic
1007870197 6:45026948-45026970 GAGTAGAAGGGAAGTCTGGAGGG - Intronic
1007900624 6:45408301-45408323 TAGGAAAAGGGAAATATGAAGGG + Intronic
1008111245 6:47497356-47497378 AAGGAGAAGGGGAAGGGGAAGGG - Intronic
1008340188 6:50355003-50355025 AGCAAGAAGAGAAATGTGGAAGG + Intergenic
1008393587 6:50981310-50981332 AAAGAGAAGGGAAAGTTGGTGGG + Intergenic
1008810027 6:55485202-55485224 CAGAAGATGGGAAATTTGGAGGG - Intronic
1009390777 6:63140633-63140655 AAAGAGAAGGGAAGAGGGGAAGG + Intergenic
1009606157 6:65870297-65870319 AAGCAGAAGGGAAAATGGGACGG + Intergenic
1009611643 6:65950318-65950340 AAGGAGAAGGAAAATGTGGTTGG - Intergenic
1009804461 6:68585182-68585204 AAAGTGAAGGGAAGTGGGGAGGG + Intergenic
1009860066 6:69317312-69317334 AAGGAGAAAGGAGAGGAGGAGGG + Intronic
1010015979 6:71105299-71105321 AAGCTTAAGGGAAATGTGGAGGG - Intergenic
1010047982 6:71469801-71469823 GAAGAGAAGGCAAATGAGGAGGG - Intergenic
1010143232 6:72635581-72635603 AGGGAAAATGTAAATGTGGAAGG - Intronic
1010386373 6:75284878-75284900 AAGAAGGAGGGACATGGGGAGGG + Exonic
1010434249 6:75811791-75811813 AAGGAAAAGAGAAAGGGGGAGGG + Intronic
1010507244 6:76675615-76675637 AAGGGGAAGGGAAAGGGGAAGGG - Intergenic
1010579382 6:77575308-77575330 AGAGAGATGGGAAGTGTGGATGG - Intergenic
1010687343 6:78867972-78867994 AGCGGGAAGGGAGATGTGGAGGG + Intronic
1010813526 6:80327879-80327901 AAGGGGAGGGGAAAAGGGGAGGG - Intronic
1010814383 6:80339808-80339830 AAGAAGAATGGTAATGTGGAAGG - Intronic
1010872441 6:81059342-81059364 AAGGAGAAGAGAATTGTACAGGG - Intergenic
1010956004 6:82091628-82091650 AAGGTGAAGGGAATTTTGAATGG + Intergenic
1011150966 6:84273018-84273040 AAAGATAAGTGAAATGGGGAAGG + Intergenic
1012276404 6:97280174-97280196 AAGGAAAATGGAGAGGTGGAAGG - Intronic
1012447281 6:99319490-99319512 AAACAGCAGGCAAATGTGGAGGG - Intronic
1012520112 6:100110932-100110954 AACAAGGAGGGATATGTGGAGGG + Intergenic
1013313980 6:108923914-108923936 AAGGAGGAGGGGAATGAGGAGGG - Intronic
1013313984 6:108923926-108923948 AATGAGAAGGGGAAGGAGGAGGG - Intronic
1013346986 6:109270250-109270272 AGGGAGAAGGGAAAAAAGGAAGG - Intergenic
1013506931 6:110809998-110810020 AAGGATAAGGGAAAAGGGGGAGG + Intronic
1013668823 6:112376151-112376173 GAGGAGAAGGAAAATGAGGGAGG + Intergenic
1014371966 6:120621051-120621073 TAAGAGAAGGGAAACATGGAAGG - Intergenic
1014573157 6:123036619-123036641 AAGGTGAAGGGAAAAGGGGATGG - Intronic
1014684380 6:124477738-124477760 AAGGAAAAGGGGAAGGGGGAAGG - Intronic
1014904706 6:127012023-127012045 AAGAAAAAGGGAAATGAGGCAGG - Intergenic
1015113404 6:129619371-129619393 AAGGGGGAGGGAAAGGGGGAGGG + Intronic
1015113410 6:129619383-129619405 AAGGGGGAGGGAAAGGGGGAGGG + Intronic
1015123596 6:129728064-129728086 AAGGAGAAGAGAGATTTGGGTGG - Intergenic
1015997885 6:139013621-139013643 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1016173169 6:141044907-141044929 AAGGATAAAGAAAATGTGGTAGG - Intergenic
1016546414 6:145229235-145229257 AAGGAAAAGGGAAAAGGGAAAGG - Intergenic
1016595730 6:145797680-145797702 AGGGAGAAGGGAAAGGGAGAGGG + Exonic
1016756780 6:147696211-147696233 AAGGAGAAGGCAAGTTTGGAGGG - Intronic
1016998633 6:149979236-149979258 AGGGAGAAGGGAGAGGAGGATGG - Intergenic
1016999757 6:149988574-149988596 AGGGAGAAGGGAGAGGAGGATGG + Intergenic
1017006859 6:150033700-150033722 AGGGAGAAGGGAGAGGAGGATGG - Intergenic
1017339565 6:153305195-153305217 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1017541206 6:155404892-155404914 AATGAGGAGGGAGATGTGGAAGG - Intronic
1017800574 6:157892109-157892131 GAAGAGGAGGGAAAGGTGGAAGG + Intronic
1018179405 6:161207718-161207740 TAGTAGAGGGGAAATGGGGATGG + Intronic
1018256673 6:161926923-161926945 AAGGAGAAGCAAAATTTAGAGGG - Intronic
1018619420 6:165715561-165715583 AAGGAGGAGGGAGAGGTGAAGGG + Intronic
1018671164 6:166178470-166178492 TAGGAGGAGGGAAAGCTGGAAGG + Intergenic
1018831359 6:167446099-167446121 AAGCAGAGGGGAAACGTGTAGGG - Intergenic
1019159077 6:170057617-170057639 AGGGGGAAGGGAAAGGGGGAGGG - Intergenic
1019159101 6:170057664-170057686 AGGGGGAAGGGAAAGGGGGAGGG - Intergenic
1019191205 6:170251967-170251989 AAGGAGAAGTGAATGGTGGCTGG - Intergenic
1019855187 7:3598604-3598626 GGGGACAAGGGAAATGAGGAAGG - Intronic
1019860717 7:3656189-3656211 AAGGAGAAGGGAAGGATGGAGGG - Intronic
1019955074 7:4406953-4406975 AAGGAAAAGAGTAATCTGGAAGG + Intergenic
1020184264 7:5946939-5946961 AAGCAGTTAGGAAATGTGGAGGG - Intronic
1020298653 7:6777827-6777849 AAGCAGTTAGGAAATGTGGAGGG + Intronic
1020585556 7:10061257-10061279 AAGGAAAAGGCAATTGTGGCTGG - Intergenic
1021059995 7:16099469-16099491 AAGGAGAAGGGAAGAGGGAAGGG + Intronic
1021289383 7:18823995-18824017 AAGGAGAAGGGGAATGGGAAGGG + Intronic
1021311156 7:19099044-19099066 AAGGAGAAGGGCAATATTAATGG + Intronic
1021316106 7:19149143-19149165 AAGAGGAAGGGACATGAGGAAGG - Intergenic
1021337273 7:19419347-19419369 GAGGAGATGAGAAATGTTGATGG + Intergenic
1021674603 7:23067651-23067673 CAGGGGAAGGGAAAGGTGGATGG + Intergenic
1021847715 7:24778882-24778904 AAGGAGAAAATAAATTTGGAGGG + Intergenic
1022061349 7:26799024-26799046 AAGGGGAGGGGAAAAGAGGAGGG + Intronic
1022203769 7:28143122-28143144 AAGGAGATGAGAGTTGTGGAAGG - Intronic
1022212359 7:28224140-28224162 AAGGAGAAAAGAAATGGGGTCGG - Intergenic
1022274426 7:28841823-28841845 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1022290835 7:29000987-29001009 AAGGAGAAGGCTAATTTGGAAGG + Intronic
1022357055 7:29625792-29625814 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1022499822 7:30875709-30875731 AATGAGGAGGGAAGTGGGGAAGG + Intronic
1022560177 7:31339553-31339575 AAGGCAAAGAGAAATGTAGATGG - Intronic
1022670304 7:32449369-32449391 AAGGAGAAGGGGAACGGGAAGGG + Intergenic
1023911138 7:44557668-44557690 AAGGGGAAGGGAAAGGGGAAGGG + Intergenic
1024186947 7:46958984-46959006 GGAGTGAAGGGAAATGTGGAAGG + Intergenic
1024337622 7:48225237-48225259 AAGGAGAGAGGAAAGATGGAAGG - Intronic
1024439754 7:49403678-49403700 AAGGAGAAGGGAAGGAAGGAAGG + Intergenic
1024737683 7:52323360-52323382 AGGGAGAAGGGAAAGGGGAAGGG - Intergenic
1024737698 7:52323400-52323422 AGGGAGAAGGGAAAGGGGAAGGG - Intergenic
1024737743 7:52323528-52323550 AGGGAGAAGGGAAGTGGGAAGGG - Intergenic
1025085922 7:56023177-56023199 AAGGAGAACGAAAATGGTGAAGG + Intronic
1025108988 7:56196896-56196918 GAGGGGAAGGGAAAGGGGGAGGG - Intergenic
1026078891 7:67199575-67199597 ATGCTGAAGGCAAATGTGGAAGG - Intronic
1026178223 7:68016366-68016388 AAGGAGAAAGGAAGGATGGATGG - Intergenic
1026241727 7:68581429-68581451 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1026355486 7:69553564-69553586 CTGGAGAAGGGAAGTGGGGAAGG - Intergenic
1026439815 7:70434338-70434360 AGGGAGAAGGGAGTTGTGAATGG + Intronic
1026666564 7:72345510-72345532 AGGGAGGAAGGAAATGAGGAAGG + Intronic
1026697929 7:72612368-72612390 ATGCTGAAGGCAAATGTGGAAGG + Intronic
1026800617 7:73397785-73397807 AAGGAGAAGGGGGAGGAGGAGGG + Intergenic
1027591478 7:80124639-80124661 AAAGAGAAGAGAGATCTGGAGGG + Intergenic
1028011736 7:85653629-85653651 AAGGAGAAGAAAAATTTGGTAGG - Intergenic
1028127697 7:87132891-87132913 AAGGAGGGGGGAAATGGGGGTGG + Intergenic
1028887501 7:95950410-95950432 GAGGACAAAGTAAATGTGGATGG - Intronic
1029354377 7:100040647-100040669 AAGGAGAAGGGGGAAGAGGACGG + Exonic
1029577595 7:101413675-101413697 GAAGGGAAGGGAAATGAGGAAGG + Intronic
1029795855 7:102893830-102893852 AAGGGGAAGGGAAAGGCGAAGGG + Intronic
1030021421 7:105278733-105278755 AAGGAAAGGGGAAAAGGGGAAGG + Intronic
1030109394 7:106013609-106013631 AAGGAGAAGAGAAAAATGAAAGG + Intronic
1030296328 7:107932285-107932307 AAGGAGAGAGGAAGTGTGGGGGG - Exonic
1030327018 7:108230460-108230482 ATGAAGTAGGGAAATGTTGAAGG - Intronic
1030564879 7:111141305-111141327 ATTGGGAGGGGAAATGTGGAGGG - Intronic
1030607812 7:111656896-111656918 AAGGAGAATGAAAATGAGCAGGG + Intergenic
1030690872 7:112531670-112531692 GAGGAGATGGGAGATCTGGAAGG + Intergenic
1030741012 7:113110067-113110089 AAGGAGAAGGAAGAAGTAGAAGG + Intergenic
1030925003 7:115441006-115441028 AAGGAGAAAGGGAAGGAGGAAGG + Intergenic
1031524270 7:122805594-122805616 AAAGAGAAGGCAATTTTGGAAGG - Intronic
1031533487 7:122905598-122905620 AAAGAGAAGGGAAAAGAGAAAGG - Intergenic
1031595108 7:123640723-123640745 GAGGAGAAGGGGAAGGGGGAAGG + Intergenic
1031696178 7:124857682-124857704 AAGGGGAAGTGAAAAGAGGATGG - Intronic
1031805121 7:126298388-126298410 AAGGAAAATGGAAAATTGGAAGG + Intergenic
1031865992 7:127039630-127039652 AAGGAGAAGGGGAAGGGGAAGGG + Intronic
1031955402 7:127937470-127937492 GAGGAGAAGGGACAGGGGGAGGG - Intronic
1032044965 7:128597684-128597706 AGGAAGAAGGGAGATGTAGAGGG + Intergenic
1032144045 7:129362687-129362709 AAGGAAGAGTGAACTGTGGAAGG - Intronic
1032306370 7:130735463-130735485 AAGGTGAATGGAACTGGGGAGGG - Intergenic
1032571517 7:133004675-133004697 GAGGAGAAAGGCAATGTGAAGGG + Intronic
1032739281 7:134722767-134722789 TAGCAGAAAGGAAAGGTGGAGGG - Intergenic
1033024168 7:137756813-137756835 AAGGGCAAGGGAAATGTGTTGGG - Intronic
1033033990 7:137853892-137853914 ATGGAGAAAGGGAATGTGAATGG - Intergenic
1033166468 7:139042786-139042808 AGGGAGGAGGGAAATGGAGAGGG - Intergenic
1033384732 7:140861843-140861865 AAGTAGAAAGGAAAAGTGGGAGG + Intronic
1033804324 7:144937416-144937438 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1033804342 7:144937470-144937492 AAGGAGAAGGGAAAGGAGAAAGG - Intergenic
1033848027 7:145459051-145459073 AAGGAGAAGGGAAAGGAGTGAGG - Intergenic
1034055678 7:148032549-148032571 AAGGAGAAGTGACATATGGGAGG + Intronic
1034129430 7:148701331-148701353 AGGGAGAAGGGAAGTGAAGAGGG - Intronic
1034277613 7:149830556-149830578 GAGGAGGAGGGGACTGTGGAGGG - Intergenic
1034336520 7:150327212-150327234 AAGGAGAAGGGAAGTGAAAAGGG + Intronic
1034380894 7:150691403-150691425 ACGTTGAAGGGAAATGGGGAAGG + Intronic
1034417017 7:150970607-150970629 CTAGAGAAGGGAAAGGTGGAGGG + Intronic
1034944920 7:155255652-155255674 AAGAAGAAGGGGAAAGGGGAAGG + Intergenic
1035713764 8:1738460-1738482 ACGGAGGAGGGAAATGGGCAGGG + Intergenic
1035856958 8:2985966-2985988 AAGGGGAAGGGAAAGGGGAAGGG + Intronic
1036082620 8:5573996-5574018 AAAGAAAAAGGAAATTTGGATGG + Intergenic
1036505040 8:9347462-9347484 AAGGGGAAGGGAAGGGAGGAGGG + Intergenic
1036546186 8:9771787-9771809 GAGGAGAAGGGAAGTGGGGGAGG + Intronic
1036612983 8:10366000-10366022 AAGGAGCAGGGGAATGAGGCAGG - Intronic
1036661897 8:10714374-10714396 AGGGAGAAAGGAAAAGGGGAGGG - Intergenic
1036707172 8:11054719-11054741 AAGGAGGAAGGAAGTGTGGGTGG + Intronic
1036718041 8:11144894-11144916 AAGGAGAAGGGGAAGGGGAAGGG + Intronic
1036960095 8:13235365-13235387 AAATACAAGGAAAATGTGGAGGG + Intronic
1037696494 8:21228540-21228562 CAAGAGAAGGGAACTGGGGAAGG + Intergenic
1037738273 8:21583821-21583843 AAGGAAAAGGGAAATGAAAAGGG - Intergenic
1037908331 8:22728409-22728431 AAGGAGCAGGAGACTGTGGAAGG + Intronic
1038001594 8:23396388-23396410 AGGGAGGAAGGAAATGAGGAGGG + Intronic
1038349402 8:26762608-26762630 AAGGAGATGGGAAAGATGAAAGG + Intronic
1038351380 8:26779319-26779341 ATGGAGAAGGAAAATTTGGAAGG - Intronic
1038547685 8:28438379-28438401 AAGAAGAAGAGAAATGGGGACGG + Intronic
1038675104 8:29616162-29616184 AAGGGGAAGGGAAAGGGGAAGGG + Intergenic
1039031305 8:33312470-33312492 TAGGAGAGGGGGGATGTGGAAGG - Intergenic
1039436022 8:37559701-37559723 GAGGAGAAGGAAAAGGAGGAGGG + Intergenic
1039450801 8:37673576-37673598 AAGGCCAAGGGATATGTGGGAGG - Intergenic
1040564274 8:48552149-48552171 AAGGAGGAGCGAAAGGAGGAGGG - Intergenic
1040675588 8:49745609-49745631 AAAAAGAAAGGAAATGTAGAAGG + Intergenic
1040735427 8:50501306-50501328 AAGGAGAAGGAAAATCTGATTGG - Intronic
1040794136 8:51271221-51271243 AAGGAGAGGCGAGGTGTGGAGGG + Intergenic
1041067045 8:54092093-54092115 AAGGAGAAGGAAGAGGGGGAGGG + Intronic
1041248710 8:55914068-55914090 ATGGAGAATGGAGAGGTGGAGGG + Intronic
1041284832 8:56249545-56249567 AAGGGGAAGGGAAAGGGGAAGGG - Intergenic
1042435052 8:68754530-68754552 AAGGCCCAGGGAAATTTGGATGG - Intronic
1042460045 8:69054680-69054702 AAGAAAAAGGGAGATGGGGAGGG + Intergenic
1042599269 8:70481995-70482017 AGAGAGAAGGGTAATGTGGAAGG - Intergenic
1042810604 8:72821809-72821831 AAGGTGAAGGGAAGGATGGAGGG + Intronic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043764748 8:84116588-84116610 AAGGAGAAAGGAAATAAGAAAGG + Intergenic
1043796672 8:84550234-84550256 AAGGAAAAGGAGAAAGTGGAGGG - Intronic
1043938288 8:86167979-86168001 AAGGGGAAGGGGAAGGGGGAGGG + Intergenic
1044084927 8:87932849-87932871 AATGATAAAGGAAATCTGGAAGG - Intergenic
1044289520 8:90451483-90451505 AAGGAAAAGAAAAAAGTGGAAGG - Intergenic
1044492367 8:92834608-92834630 GTGGAGAAGGGACAGGTGGAGGG - Intergenic
1044928014 8:97225339-97225361 AAGGAGATTGGAAATAAGGAAGG + Intergenic
1045230584 8:100302717-100302739 AAGGAGACAGAAAAGGTGGAAGG + Intronic
1045778970 8:105841245-105841267 AAGGAGAAGGGGAATGAAGGAGG - Intergenic
1046013390 8:108577050-108577072 AAGAAGAAGGGAATTGGGAAAGG - Intergenic
1046015606 8:108601138-108601160 AAGGAGGAGGGAGAGGGGGAGGG + Intergenic
1046476603 8:114752674-114752696 AAAGGGAAGGGAAATGTGTAGGG + Intergenic
1046592217 8:116220464-116220486 AAGAAGAAGGGAAAGAGGGAAGG - Intergenic
1046677155 8:117122509-117122531 AAGGAGAGGGAAAAGTTGGATGG - Intronic
1046698590 8:117373669-117373691 GAGGAGAAGAGAAAGGGGGAGGG + Intergenic
1047050879 8:121111692-121111714 AGGGTGAGAGGAAATGTGGAGGG + Intergenic
1047240130 8:123079775-123079797 AAGGAGAAAGGAAAGCTTGAAGG - Intronic
1047523724 8:125615286-125615308 AAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1047692971 8:127375218-127375240 AAAGAGAAGGAAGATGTGAAGGG - Intergenic
1047701395 8:127452702-127452724 AAGGGGAAGGGAGAGGGGGAAGG + Intergenic
1048207981 8:132430972-132430994 TGGGAGAAGGGAAAATTGGAAGG - Intronic
1048408074 8:134143100-134143122 AAGGAGGAAGGAAGGGTGGAAGG - Intergenic
1048588919 8:135802947-135802969 AAGGAGAAGGGGAACGGGAAGGG - Intergenic
1048590299 8:135815149-135815171 AATGAGAAGGGAAAAGAGAAGGG + Intergenic
1048922031 8:139239994-139240016 AAGGACAAGGGCTAGGTGGAGGG + Intergenic
1049210593 8:141384800-141384822 AGGGAGATGGCAACTGTGGATGG + Intergenic
1049280842 8:141743387-141743409 CTGGAGAAGGGTAATGGGGAAGG + Intergenic
1049913842 9:297114-297136 AAGGAGAAAGAAGATGTGAAAGG + Intronic
1050301288 9:4261338-4261360 AAAGAGAAGAGAAATAGGGATGG + Intronic
1050358550 9:4805396-4805418 AAGGAGAAGGGGAAGGGGAAGGG + Intronic
1050723597 9:8620326-8620348 AAGGAGAAGAGACAGGTAGAAGG - Intronic
1050741382 9:8824273-8824295 AGGGAGAGGGGAAATGTCAAAGG - Intronic
1050822064 9:9891117-9891139 AGGAAAAAGGGAAATGTAGACGG + Intronic
1050910284 9:11059557-11059579 AAGGTGAAGGGAACTCTTGATGG - Intergenic
1051086633 9:13357605-13357627 AAGGAGTAGGGGAATGTTTAGGG - Intergenic
1051886572 9:21899396-21899418 AAGGAGAAGGGGAAGGGGAAGGG + Intronic
1051937591 9:22462055-22462077 AAGGAGAAGGGAATTATACAGGG + Intergenic
1052141092 9:24984929-24984951 ATGGAGAAGGGAAAGGAGAAAGG + Intergenic
1052515964 9:29480156-29480178 AAGGAAAAGGAAAATAAGGAGGG - Intergenic
1052615083 9:30828852-30828874 CAGAGGAAGGGTAATGTGGATGG + Intergenic
1052976789 9:34417051-34417073 AAGGAGAAGGGGAAGGGGAAAGG - Intronic
1053335343 9:37265205-37265227 AAGGAGAAGGCAAATGTAAAAGG - Intronic
1053453742 9:38214719-38214741 AAGGAGAAGGGGAAAGGGGTTGG + Intergenic
1055375778 9:75647399-75647421 AGAGGGAAGGGAAATGAGGAAGG - Intergenic
1055707938 9:79028047-79028069 TAGGAGAAGGGAGAGGTGAAGGG + Intergenic
1056688036 9:88782861-88782883 ATGGGGAAGGGAAGAGTGGAGGG + Intergenic
1056755073 9:89376726-89376748 AAGGTAAAGGAACATGTGGAGGG + Exonic
1056879037 9:90371524-90371546 GAGGAGAAGGGAGATGGGAACGG - Intergenic
1056964364 9:91153627-91153649 AATGAGTAGGGAAAGGTGGAGGG + Intergenic
1057247006 9:93465044-93465066 TAGGAGAAGGGAAAACAGGAAGG + Intronic
1057730112 9:97601161-97601183 AAGGAGAAGCCAAATGGGGATGG - Exonic
1057739364 9:97698388-97698410 GAGGGGAAGGGAGATGGGGATGG - Intergenic
1058075350 9:100644937-100644959 AAGGAGAAAGGAAAGGAGAAAGG - Intergenic
1058540873 9:106011487-106011509 AAGAAAGAGGGAAATGTGGTTGG + Intergenic
1058665757 9:107313896-107313918 AAGGAGAAAGGAAAGGAGAAAGG - Intronic
1058817564 9:108699042-108699064 AAGGGGAAGGGAAAGGGGGATGG + Intergenic
1059323853 9:113490316-113490338 CTGGAGAAGGGGAAAGTGGATGG - Intronic
1059561472 9:115338830-115338852 AAGGAGAAGGGAAATGTGGAAGG - Intronic
1059710669 9:116865025-116865047 GAGGAGAGGGTAAATGTGGCTGG - Intronic
1059730233 9:117049974-117049996 AAGGAGAAAGGAAAGGTGGTGGG + Intronic
1060174240 9:121485779-121485801 AAGAAGGAGGGAAGTGGGGAAGG + Intergenic
1060389523 9:123267351-123267373 TAGGAGAAGGGTGATGGGGATGG - Intronic
1060848533 9:126856678-126856700 AAGGAAAAAGGAAAGGAGGAAGG - Intergenic
1061013948 9:127971349-127971371 AAGCAGAATGGAAAGGAGGAGGG - Intronic
1061979031 9:134089314-134089336 AAGAAGAAGGGAAAGATGGCTGG + Intergenic
1062050506 9:134444402-134444424 AAGGAGGAGGGGAAGGAGGAGGG - Intergenic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062182053 9:135196182-135196204 AGAGAGAAGGGGAATGTGAAGGG - Intergenic
1062182246 9:135196721-135196743 AATGGGAGGGGAAATGGGGATGG - Intergenic
1062227970 9:135464576-135464598 CACCAGAAGGGAAATGTGGCCGG + Intergenic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1062638429 9:137503655-137503677 AAGGAGAAGGGGAAGGAAGAAGG + Intronic
1203367276 Un_KI270442v1:269858-269880 AGGGAGAAGGGATTAGTGGAGGG - Intergenic
1185499100 X:584169-584191 AAGGAGGAGGGAGAGGAGGAGGG + Intergenic
1185499126 X:584269-584291 AAGGAGGAGGGAGAGGAGGAGGG + Intergenic
1185499154 X:584369-584391 AAGGAGGAGGGAGAGGAGGAGGG + Intergenic
1185499223 X:584636-584658 GAGGAGAAGGGAGAGGAGGAGGG + Intergenic
1185598698 X:1324503-1324525 AAGGAGGAGGGAAAGAAGGAAGG + Intergenic
1186034696 X:5409289-5409311 TAGGAGGTGGGAAATGTGGGGGG + Intergenic
1186145760 X:6622031-6622053 AAGGAGAAAGGGAAGGAGGAGGG + Intergenic
1186164115 X:6808564-6808586 AAGGAGAAGGGAAATGGAAAGGG - Intergenic
1186264634 X:7818805-7818827 AAGGAGAAGGGGAAGGAGTAGGG + Intergenic
1186364010 X:8872887-8872909 AAGGAAGAGGGAAAGGAGGAGGG - Intergenic
1186413140 X:9361126-9361148 AATGAGAAGCGAAATTTGGTGGG - Intergenic
1186471168 X:9823107-9823129 AAGGAGAAGGGAGAAGGAGAAGG - Intronic
1186471171 X:9823120-9823142 AAGGAGAAGGGAGAAGGAGAAGG - Intronic
1186518722 X:10186620-10186642 AAGGAGGAGGGGAATGTGTAGGG + Intronic
1186537620 X:10366125-10366147 AACCAGAAAGGAAATGTGAACGG + Intergenic
1186561566 X:10618906-10618928 AAGGAGAAGGGTAATTGGAAAGG - Intronic
1186924700 X:14320435-14320457 AAGGAGAAGAGAAACAAGGATGG - Intergenic
1186925387 X:14328283-14328305 CTGGAGAGGGGAAATGTGCAAGG - Intergenic
1187209664 X:17217008-17217030 AAGGAGAAGGGAAAACTTGGAGG - Intergenic
1187254748 X:17632145-17632167 AAAGAGAAGGAGAATGTGGAAGG + Intronic
1187309063 X:18123127-18123149 AAGGAGAAGGGGAGTGGGGGAGG - Intergenic
1187576195 X:20559078-20559100 AAGGAGAAGGGAAGGGGGAAAGG - Intergenic
1187682998 X:21786767-21786789 AATGAGAATGGAAAAGTGAAAGG + Intergenic
1188331807 X:28881931-28881953 AAGGAGAAGAGAGAGATGGACGG + Intronic
1188467068 X:30493717-30493739 AAGGAGGAGGGAAATGTTATTGG - Intergenic
1188978871 X:36708182-36708204 AAGGGGAGAGTAAATGTGGAGGG + Intergenic
1189070224 X:37855966-37855988 AATGAGAAGATAAATGTGCAAGG - Intronic
1189463634 X:41262151-41262173 AAGGAGAAAGGAAAGGAGTAAGG - Intergenic
1189463642 X:41262197-41262219 AAGGAGAAAGGAAAGGAGAAAGG - Intergenic
1189585496 X:42456999-42457021 AAGGAGAGAGGAAAAGAGGAGGG - Intergenic
1189684401 X:43548820-43548842 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1189700852 X:43715521-43715543 GAGGAGACAGGAAGTGTGGAAGG + Intronic
1190040542 X:47067949-47067971 TAGGAGCAGGGAAAGGTGGGAGG + Intergenic
1190094392 X:47467152-47467174 GAGGAGAGGGAGAATGTGGAAGG - Intronic
1190136004 X:47798608-47798630 GAGGAGAGGGGGGATGTGGAGGG - Intergenic
1190414502 X:50167531-50167553 TAGGAGAAGATAAATCTGGAGGG + Intergenic
1190418097 X:50200600-50200622 AAAGAGAAGGGATATCTTGATGG - Intronic
1190520815 X:51277821-51277843 AGGCAGAAGGGAAAAGAGGAGGG + Intergenic
1190561953 X:51694986-51695008 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1190739461 X:53279849-53279871 AGGGAGAAAGGAAAAGAGGAAGG + Intronic
1190801982 X:53797789-53797811 AAGGAGAAGGGATTTGGGGATGG + Intergenic
1190922573 X:54869813-54869835 AAGGAGAAGAGAAAAAGGGAGGG - Intergenic
1191013174 X:55782555-55782577 AAGGTGCAGGGAAGTGTGTATGG - Intergenic
1191676287 X:63795359-63795381 GAGGAGAAGGGAAAGAAGGAAGG + Intergenic
1191767541 X:64714558-64714580 AAGGAGAAGGGATATGAAAATGG + Intergenic
1191851121 X:65587221-65587243 AAGGGGAAGGGAAAGGGGGCGGG + Intergenic
1191943563 X:66504849-66504871 AAAGAGGAGGGAAATGTAAAAGG + Intergenic
1192012598 X:67290986-67291008 AAGGAGACAGGAAAAGTTGAGGG + Intergenic
1192448953 X:71230885-71230907 AAGGAGAAGGGGAAGGGGAAGGG + Intergenic
1192466233 X:71358438-71358460 AAAAAGGAGGGAAATGTGAAAGG - Intergenic
1192481486 X:71490054-71490076 AAGTAGGAGGGGAAAGTGGAGGG - Intronic
1193047426 X:77067874-77067896 AAGGTGAAGGGAACTGTCCAAGG - Intergenic
1193975864 X:88118194-88118216 GAGAAGAAGAGAAAAGTGGAGGG - Intergenic
1194044864 X:88989971-88989993 GAAAAGAAGGGAAATGTGAAAGG + Intergenic
1195234928 X:102887846-102887868 AAGGGGAAGGGAAAGGGGAAGGG - Intergenic
1195272752 X:103249333-103249355 AAATAAAATGGAAATGTGGAGGG + Intergenic
1195416557 X:104626577-104626599 AAGGAATAGGGAAATTTGGTAGG + Intronic
1195943051 X:110180842-110180864 ATGGAGAAGGGAAGTGTGGAAGG - Intronic
1195949203 X:110249603-110249625 AAAGAAAAGGGAAATCTGGCTGG + Intronic
1195973955 X:110505124-110505146 AAGGAAAAGGAAAAGGGGGAAGG - Intergenic
1195973962 X:110505149-110505171 AAGGAGAAGGGAAAGGGAAAGGG - Intergenic
1196091787 X:111751957-111751979 AAAGAGAAGGGCAATGAGCAAGG - Intronic
1196908299 X:120460420-120460442 AAGGGAAAGGGAAATAAGGAGGG - Intronic
1197867867 X:131037652-131037674 AAGGAAAAGGGGAATGAGAAAGG - Intergenic
1198225373 X:134640468-134640490 AAGGAGAAGGGAAGGACGGAAGG - Intronic
1198724374 X:139661545-139661567 AAGGAGAAAGGAAAAGTAGGAGG + Intronic
1198871537 X:141180930-141180952 AAGGGGAAAGAAAATGAGGAAGG - Intergenic
1199089580 X:143675989-143676011 AAGGAGGAGGGAAAGGAGGGAGG - Intergenic
1199295235 X:146149864-146149886 AAGGAGATGAGAAATGCAGAGGG - Intergenic
1199369140 X:147025052-147025074 AAGGAGAAAGGAAAAGAGAAAGG - Intergenic
1199372921 X:147072782-147072804 ATGGAGAAGGAATATGGGGAAGG + Intergenic
1199389174 X:147260131-147260153 AAGCAGGAGGGAATTTTGGAAGG + Intergenic
1199430903 X:147758732-147758754 CAAGGGAAGGGAAATGTGGCAGG - Intergenic
1199543651 X:148984860-148984882 AAGGAGAAGGGATATGCTCAGGG + Intronic
1199596077 X:149506844-149506866 AAGGAGAAGGGAAAATGGCAGGG + Intronic
1199896900 X:152135454-152135476 GAGGAGGAGGGAAAAGAGGATGG + Exonic
1200031144 X:153296923-153296945 AAGGAGAGAGGAAATGGGAAAGG + Intergenic
1200112107 X:153745639-153745661 CAGGGGAAGGAAAATGTGGCGGG + Intergenic
1200398832 X:156006984-156007006 AAATAGAAGGGACATGTGGGTGG + Intronic
1200946513 Y:8846154-8846176 AAGAACAAGGGAAATGTAAACGG + Intergenic
1201104922 Y:10756421-10756443 AAATAGAATGGAAATGTGAAAGG - Intergenic
1201131058 Y:10952310-10952332 AAGGAGAAGAGAGGAGTGGAAGG - Intergenic
1201853305 Y:18512893-18512915 AGGGAAAAGGGAAATGAGCAAGG - Intergenic
1201880016 Y:18807491-18807513 AGGGAAAAGGGAAATGAGCAAGG + Intronic
1201942578 Y:19475686-19475708 AATGTGCAAGGAAATGTGGAAGG + Intergenic
1202101127 Y:21309184-21309206 AAGGAGGAAGGAAAGGAGGAAGG + Intergenic