ID: 1059567055

View in Genome Browser
Species Human (GRCh38)
Location 9:115393464-115393486
Sequence TTTCCAGAAGGTCAGTCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059567051_1059567055 27 Left 1059567051 9:115393414-115393436 CCAAGCTGAGAGCATCTTTTGAA 0: 1
1: 0
2: 2
3: 50
4: 601
Right 1059567055 9:115393464-115393486 TTTCCAGAAGGTCAGTCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059567055 Original CRISPR TTTCCAGAAGGTCAGTCCTC AGG Intronic
No off target data available for this crispr