ID: 1059569829

View in Genome Browser
Species Human (GRCh38)
Location 9:115422946-115422968
Sequence CGACATAAACTGATGGGCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 71}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059569822_1059569829 13 Left 1059569822 9:115422910-115422932 CCAGCCTTAGGGGACCATTCTTA 0: 1
1: 0
2: 0
3: 9
4: 108
Right 1059569829 9:115422946-115422968 CGACATAAACTGATGGGCCTAGG 0: 1
1: 0
2: 0
3: 1
4: 71
1059569824_1059569829 -1 Left 1059569824 9:115422924-115422946 CCATTCTTAGTTTGCCCAGAATC 0: 1
1: 0
2: 0
3: 22
4: 332
Right 1059569829 9:115422946-115422968 CGACATAAACTGATGGGCCTAGG 0: 1
1: 0
2: 0
3: 1
4: 71
1059569823_1059569829 9 Left 1059569823 9:115422914-115422936 CCTTAGGGGACCATTCTTAGTTT 0: 1
1: 0
2: 0
3: 9
4: 94
Right 1059569829 9:115422946-115422968 CGACATAAACTGATGGGCCTAGG 0: 1
1: 0
2: 0
3: 1
4: 71
1059569820_1059569829 23 Left 1059569820 9:115422900-115422922 CCTTAGGATGCCAGCCTTAGGGG 0: 1
1: 0
2: 0
3: 8
4: 102
Right 1059569829 9:115422946-115422968 CGACATAAACTGATGGGCCTAGG 0: 1
1: 0
2: 0
3: 1
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059569829 Original CRISPR CGACATAAACTGATGGGCCT AGG Intergenic
904464688 1:30700858-30700880 CGCCCTAAAGTGCTGGGCCTAGG - Intergenic
908912615 1:69089593-69089615 GGACATATACAGATGGACCTAGG - Intergenic
910075718 1:83276195-83276217 CCACAGAAACTGGTGGGGCTGGG - Intergenic
917384261 1:174452351-174452373 CCTCATAAACTGCTTGGCCTTGG + Intronic
1068671187 10:59725292-59725314 CGAAATAAAGTGATGGGCTCTGG + Intronic
1071756267 10:88543968-88543990 AGACCTAAACTGCTGTGCCTTGG - Intronic
1081981281 11:47268915-47268937 CCCCACAAACGGATGGGCCTGGG + Intronic
1092574712 12:9768223-9768245 CTACATAAACTTATGGCACTGGG + Intergenic
1092833827 12:12469535-12469557 TTACATAAACTAATGGCCCTGGG + Exonic
1096478202 12:51921374-51921396 AGAGAGAAACTGATGGGCCCTGG - Intronic
1096575534 12:52550423-52550445 CTTCTTAAACTGTTGGGCCTTGG - Intronic
1099279515 12:80625874-80625896 TTCCATAAACTGATGTGCCTAGG - Intronic
1101897219 12:108765775-108765797 CAGCCTAAATTGATGGGCCTTGG - Intergenic
1119459822 14:74791371-74791393 GAAAATAAAATGATGGGCCTTGG + Intronic
1126914235 15:53447869-53447891 GGACATAAAATTATGGCCCTGGG + Intergenic
1149248974 17:54746014-54746036 CGAAATAAAGGGATGGGCTTTGG + Intergenic
1149632419 17:58137480-58137502 CGACATAAATTTATTGGCCATGG + Intergenic
1153523639 18:5975424-5975446 CCAGATAAATTGATGGGACTTGG - Intronic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1163393803 19:17046881-17046903 TGAAATACACTGATGGGACTGGG + Intergenic
1166159174 19:40938924-40938946 GGACACAGACTGAAGGGCCTGGG - Intergenic
929730535 2:44486723-44486745 TGGCCCAAACTGATGGGCCTGGG - Intronic
933279902 2:80322295-80322317 CTACATAAAATGAGGGGCTTAGG - Intronic
946613321 2:221482373-221482395 TGACAGAAACTGATTGGTCTGGG + Exonic
948052381 2:234988446-234988468 CTACATAAACTGATGGCCAGGGG - Intronic
1172226224 20:33306872-33306894 GGTCAGAAACTGATGGGCCTGGG - Intronic
1173182601 20:40816046-40816068 AGACACAAACTGAAGAGCCTGGG + Intergenic
1173236348 20:41249546-41249568 CTCCACAGACTGATGGGCCTGGG - Intronic
949373769 3:3364371-3364393 GGCTATAAACTGATGGGCGTGGG - Intergenic
959028561 3:101270922-101270944 GGAAATAAATTGATGGACCTTGG + Intronic
959142236 3:102500194-102500216 CAACATAATCTGAGAGGCCTGGG + Intergenic
962262654 3:133924033-133924055 AAACACAAACTGATGGGCTTAGG + Intergenic
963695114 3:148557130-148557152 GGAAATAAACTTAGGGGCCTAGG - Intergenic
963774410 3:149423403-149423425 GGAAATACACAGATGGGCCTAGG + Intergenic
969185941 4:5474283-5474305 CTTCAGAATCTGATGGGCCTGGG + Intronic
975464714 4:74696346-74696368 CTACATAAACAGATGGGTATGGG + Intergenic
978181079 4:105796687-105796709 GGTCACAAACTGATGGTCCTTGG + Intronic
980842903 4:138287943-138287965 AGACATAAACTAATTGCCCTAGG - Intergenic
986052231 5:4101021-4101043 GGAGAAAGACTGATGGGCCTTGG - Intergenic
1003323007 6:5069245-5069267 CCAAATAAACTGATGGTCTTTGG - Intergenic
1010204289 6:73309052-73309074 TGACCTCAAGTGATGGGCCTTGG + Intronic
1010368782 6:75083443-75083465 CAAAATAAACTGATGGAACTTGG + Intergenic
1013498383 6:110721541-110721563 AGCCAGAAACTAATGGGCCTTGG - Intronic
1013739196 6:113263646-113263668 CGAAATAAAGGGATGGGCTTTGG + Intergenic
1019590507 7:1828056-1828078 AGAGACAAACTGATGGGCCCCGG - Intronic
1021301603 7:18980119-18980141 AGAGATAAAATGATGGCCCTGGG - Intronic
1027293431 7:76741069-76741091 CCACAGAAACTGGTGGGGCTGGG - Intergenic
1027796953 7:82707602-82707624 GAAAATAGACTGATGGGCCTTGG + Intergenic
1031747998 7:125529493-125529515 CAACATAGACTGATGAGCCATGG - Intergenic
1039683369 8:39767035-39767057 TGACATAAACTGATGGGATGAGG + Exonic
1041309363 8:56498841-56498863 CCTAAAAAACTGATGGGCCTGGG + Intergenic
1042567270 8:70124707-70124729 CGACATAAATGGATGGGCGCAGG - Exonic
1048173891 8:132134256-132134278 GGACATGGACTGATGGGCCAGGG - Intronic
1048283875 8:133126336-133126358 TGACTTAAACAGTTGGGCCTTGG + Intronic
1048531095 8:135251242-135251264 GGACCTCAACTGATGTGCCTTGG - Intergenic
1048811086 8:138286904-138286926 GGAAGTAAACTGGTGGGCCTGGG - Intronic
1049698705 8:143996688-143996710 CGCCATAATCTGCTGGACCTTGG + Intronic
1051640240 9:19218084-19218106 TAACATAAACTGAAGAGCCTAGG - Intergenic
1053545495 9:39018895-39018917 GGACATACATAGATGGGCCTAGG + Intergenic
1053809825 9:41840593-41840615 AGACATACATAGATGGGCCTAGG + Intergenic
1054620768 9:67346835-67346857 AGACATACATAGATGGGCCTAGG - Intergenic
1057923389 9:99119142-99119164 AGAAATGAACTGATGGTCCTGGG - Intronic
1058645191 9:107125480-107125502 TGAAATAAGCTGATGGGCCAGGG + Intergenic
1059569829 9:115422946-115422968 CGACATAAACTGATGGGCCTAGG + Intergenic
1187732766 X:22272554-22272576 AAACAGAAACTGATGGGCGTGGG - Intergenic
1192639731 X:72850375-72850397 AGAAATAAAGTGATGGGCATTGG + Intergenic
1192641980 X:72870430-72870452 AGAAATAAAGTGATGGGCATTGG - Intergenic
1197544258 X:127804332-127804354 AGACATAAACAAATGGGCATGGG + Intergenic
1200830214 Y:7681453-7681475 TAACAGAAAATGATGGGCCTGGG - Intergenic
1200887409 Y:8282635-8282657 TTACAGAAAATGATGGGCCTGGG - Intergenic
1202186162 Y:22186436-22186458 TAACAAAAAATGATGGGCCTGGG - Intergenic
1202196649 Y:22305260-22305282 TAACAGAAAATGATGGGCCTCGG + Intergenic
1202205197 Y:22399960-22399982 TAACAAAAAATGATGGGCCTGGG + Intronic