ID: 1059570112

View in Genome Browser
Species Human (GRCh38)
Location 9:115425241-115425263
Sequence GTCCCAGCCTTGGCTAAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2106
Summary {0: 1, 1: 36, 2: 172, 3: 582, 4: 1315}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059570112_1059570121 22 Left 1059570112 9:115425241-115425263 CCCCTTTTAGCCAAGGCTGGGAC 0: 1
1: 36
2: 172
3: 582
4: 1315
Right 1059570121 9:115425286-115425308 TGCACAAAGCAACAAGGTGCTGG 0: 1
1: 4
2: 14
3: 174
4: 403
1059570112_1059570122 23 Left 1059570112 9:115425241-115425263 CCCCTTTTAGCCAAGGCTGGGAC 0: 1
1: 36
2: 172
3: 582
4: 1315
Right 1059570122 9:115425287-115425309 GCACAAAGCAACAAGGTGCTGGG 0: 1
1: 4
2: 14
3: 160
4: 350
1059570112_1059570120 16 Left 1059570112 9:115425241-115425263 CCCCTTTTAGCCAAGGCTGGGAC 0: 1
1: 36
2: 172
3: 582
4: 1315
Right 1059570120 9:115425280-115425302 TGAGACTGCACAAAGCAACAAGG 0: 4
1: 69
2: 93
3: 229
4: 572

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059570112 Original CRISPR GTCCCAGCCTTGGCTAAAAG GGG (reversed) Intergenic
Too many off-targets to display for this crispr