ID: 1059570175

View in Genome Browser
Species Human (GRCh38)
Location 9:115425833-115425855
Sequence CTAACTGCTGATAATGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 17, 3: 69, 4: 223}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059570175_1059570178 4 Left 1059570175 9:115425833-115425855 CCCATATCATTATCAGCAGTTAG 0: 1
1: 0
2: 17
3: 69
4: 223
Right 1059570178 9:115425860-115425882 AAGTCATTCAAAAAGTCTCTAGG 0: 2
1: 131
2: 1746
3: 2019
4: 1516

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059570175 Original CRISPR CTAACTGCTGATAATGATAT GGG (reversed) Intergenic
905002094 1:34680576-34680598 CTGTTTGCTGATAGTGATATGGG + Intergenic
906751710 1:48268236-48268258 CTAGCACATGATAATGATATGGG - Intergenic
908812328 1:67995675-67995697 CTATCTGCTGATAGTCATTTAGG - Intergenic
908872133 1:68625576-68625598 CTACCTGATGATAATTATATAGG + Intergenic
908919180 1:69169587-69169609 CAAAATGCTGATAATGATATAGG + Intergenic
909067217 1:70949768-70949790 GTAACTACTGGTAATCATATTGG - Intronic
909104434 1:71391347-71391369 CAAAATGCTGATAGTGATACAGG + Intergenic
909813997 1:79967773-79967795 ATGACTGCTGAAAATGATGTAGG + Intergenic
911407731 1:97463659-97463681 AAAAATGCTGATAATGATAAGGG + Intronic
912121607 1:106478856-106478878 CAAAATGCTGATGATGATATGGG + Intergenic
912267508 1:108173766-108173788 CAAAATGCTGATAGTAATATGGG + Intronic
914504523 1:148277263-148277285 CTAACTGCTGTGAATTATAATGG - Intergenic
916121509 1:161532619-161532641 CTAACTGCTGTTAGGGAGATTGG - Intergenic
917360279 1:174167668-174167690 CTTACTGCTAATAATGAGAATGG - Intronic
919409787 1:197228546-197228568 CAAAATGCTGATAGTAATATTGG - Intergenic
920611236 1:207439816-207439838 TTAACTGCTCAAAATGTTATTGG - Intergenic
921081625 1:211743323-211743345 CTAACCGCTGGAAATGAGATGGG - Intergenic
921996673 1:221426661-221426683 CAAAATGCTGATAATGATAATGG - Intergenic
923440107 1:234009782-234009804 CAATCTGCTGATAGTCATATTGG - Intronic
924748970 1:246867781-246867803 GGAACTGCTGATAATGGTTTGGG + Exonic
1066273398 10:33845185-33845207 CAAAATGCTGATAATGATATGGG - Intergenic
1067783216 10:49224039-49224061 CAAAATGCTGATAATGATATGGG - Intergenic
1068310605 10:55269748-55269770 CTAACTGTGAAAAATGATATTGG - Intronic
1071119681 10:82262993-82263015 CTAACTGGTGTTAATGATCTGGG - Intronic
1071324921 10:84504187-84504209 CTAAATGCTCATATTTATATGGG - Intronic
1071358323 10:84820034-84820056 TGAACTGCTTATAATGATATGGG - Intergenic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1073670518 10:105582553-105582575 CAAGATTCTGATAATGATATTGG + Intergenic
1075244448 10:120808413-120808435 ATAACTGCTGTTGATGATATAGG - Intergenic
1076260810 10:129064269-129064291 ATAACTGTTGATCATGATTTGGG - Intergenic
1078393275 11:10955140-10955162 CAAAATGCTGATAGGGATATGGG + Intergenic
1078885811 11:15498708-15498730 ATAAAAGCTGATAATAATATTGG - Intergenic
1079707443 11:23638295-23638317 CAAATTGCTGATAGTGATATGGG - Intergenic
1079838742 11:25367547-25367569 CAAAATGGTGATAATTATATGGG - Intergenic
1079850304 11:25525003-25525025 CTAAATTCAAATAATGATATTGG - Intergenic
1080204986 11:29717886-29717908 CAAAATGCTGATAATAATATGGG - Intergenic
1080690258 11:34550567-34550589 CTCACTTCAAATAATGATATTGG - Intergenic
1082733212 11:56825391-56825413 CAAAATGCTGATAGTAATATGGG - Intergenic
1086197815 11:84162236-84162258 CTAACTCCTGTTAAGGATTTTGG - Intronic
1086802826 11:91198516-91198538 TTCAATGTTGATAATGATATAGG + Intergenic
1086992082 11:93314431-93314453 TAAAATGCTGATAGTGATATGGG - Intergenic
1087387917 11:97496381-97496403 CTAAGTGCTAATAATGATCTTGG - Intergenic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1087938426 11:104063217-104063239 CTTAATGTTGATGATGATATTGG - Intronic
1089075769 11:115737285-115737307 CTAATTGCTCATAATTACATTGG + Intergenic
1090644899 11:128759499-128759521 CTAAGTGATGATAGTGATTTTGG + Intronic
1091334561 11:134756749-134756771 GTAGCTGCTGCTAATGATAATGG - Intergenic
1091474814 12:762485-762507 CTAACTGCAGATGAAAATATTGG - Intronic
1092486003 12:8902533-8902555 CAAAATGCTGATAGCGATATAGG - Intergenic
1094421250 12:30273439-30273461 CAAAATGCTGATAGTAATATGGG - Intergenic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1095610141 12:44118450-44118472 TCAACTGCTGAAAATGATAAAGG + Intronic
1097841068 12:64321815-64321837 CAAACTGCTGAAAATAATAAAGG - Intronic
1098408323 12:70151242-70151264 CCAAGTGCTCATAATCATATTGG + Intergenic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099495611 12:83342710-83342732 CAAAATGCTGATAGTGGTATGGG + Intergenic
1099607848 12:84828251-84828273 CAAAATGCTAATACTGATATGGG + Intergenic
1099655168 12:85479921-85479943 CAAAATGCTGGTAGTGATATGGG - Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1099708515 12:86188732-86188754 CTAACTGCTGATAAAGAGCAAGG + Intronic
1100703583 12:97176464-97176486 TAAACTGCTGATAATGTTTTTGG - Intergenic
1101190359 12:102326181-102326203 TAAAATGCTGATAGTGATATGGG + Intergenic
1101526465 12:105535651-105535673 CAAAATGCTGATAGGGATATGGG - Intergenic
1104142609 12:126003367-126003389 CAAAATGCTGATAGTGATGTAGG + Intergenic
1104490538 12:129189883-129189905 CTAACAGCTGATGTTGAGATGGG + Intronic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1108886028 13:55182745-55182767 CTAACTTCTGAAAATACTATAGG - Intergenic
1108977018 13:56458705-56458727 CTCAATGATGATAATGATAATGG + Intergenic
1109359703 13:61280214-61280236 CAAAATGCTAATAGTGATATTGG + Intergenic
1111221242 13:85207840-85207862 CAAAGTGCTGATAGTGATATGGG + Intergenic
1112674589 13:101685463-101685485 CCATCTGCTAATAATGATCTTGG + Intronic
1112861455 13:103833063-103833085 CAAAATACTGATACTGATATTGG + Intergenic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1114917271 14:27284740-27284762 CAAAATGCTGATAAAGATTTTGG + Intergenic
1114961278 14:27893089-27893111 CAAAATGTTGATAATCATATGGG + Intergenic
1115295291 14:31819065-31819087 CTTTCTGCTGATACTAATATTGG + Intronic
1116068970 14:40018513-40018535 CTAATAGCTGATAATGAGGTAGG + Intergenic
1116377942 14:44227641-44227663 CTAAATGCATATAATGATTTGGG + Intergenic
1116784036 14:49268240-49268262 CAAAATGCTGATAGTGATTTGGG + Intergenic
1116904509 14:50391948-50391970 CAAAGTGGAGATAATGATATGGG - Intronic
1117765502 14:59078132-59078154 CGAACTGTTAAAAATGATATAGG - Intergenic
1119114084 14:72002251-72002273 CCAAATGCTGATAAAGAAATTGG + Intronic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1125433601 15:39623410-39623432 CTCACTTGTGATAATGGTATTGG - Intronic
1126512954 15:49501292-49501314 CAAAATGCTGATACTGATATGGG + Intronic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1127567524 15:60206738-60206760 CTAACCTCTAAGAATGATATTGG + Intergenic
1128979112 15:72174038-72174060 CTCTCTGCTGATAATGCTCTTGG + Intronic
1130405360 15:83595547-83595569 ATCACTGCTGATATTGATCTTGG + Intronic
1130762233 15:86832664-86832686 CAAAATGCTGACAGTGATATGGG - Intronic
1136662808 16:31780059-31780081 CAAAATGCTGGTAGTGATATGGG + Intronic
1137747016 16:50829843-50829865 CTCACTGCTGAAATTGATACAGG + Intergenic
1139083983 16:63561904-63561926 CAAAATGCTGATAATGATATGGG - Intergenic
1141345785 16:83244392-83244414 CTTACTGCTGATAAACTTATGGG - Intronic
1143764026 17:9125837-9125859 TTAACTGATGATACTGATACGGG + Intronic
1149507717 17:57209694-57209716 CTAAGTGCTGACAAAGATGTGGG + Intergenic
1153938040 18:9949000-9949022 CCAACTTCTGATAATGAGGTTGG - Intronic
1155620745 18:27776220-27776242 CTAACTGCTAACCATGAAATAGG - Intergenic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1164057608 19:21634984-21635006 CCAACTGTTGGTGATGATATGGG - Intergenic
1167701498 19:51049962-51049984 CTAAGTGTTGACAAAGATATGGG - Intergenic
1167734903 19:51288139-51288161 CTGTCTGCTGAAAATGACATGGG + Intergenic
1168702307 19:58448257-58448279 CAAAATGCTGATAATGATATGGG + Intergenic
925638535 2:5965658-5965680 CAAAATGCCGATAGTGATATGGG - Intergenic
929081501 2:38126948-38126970 CAAAATGCTCATAGTGATATGGG + Intergenic
929612688 2:43283485-43283507 CAAAATGCTGACAGTGATATGGG + Intronic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
931462153 2:62458381-62458403 TGAACTGCTGAGAATGATCTAGG - Intergenic
933046104 2:77539308-77539330 CAAAATGCTGATTGTGATATGGG + Intronic
935706431 2:105861465-105861487 CTACCTGCTGAAAGTGATAGTGG + Intronic
935795343 2:106635903-106635925 CTCACTGATGATAATGCTGTGGG + Intergenic
936850889 2:116896334-116896356 AAAAATGCTGATAGTGATATAGG - Intergenic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
938686804 2:133746121-133746143 ATCACTGCTGAGAATGTTATGGG - Intergenic
939482770 2:142770371-142770393 CAAAATGCTGATAGTGACATGGG + Intergenic
939841251 2:147189752-147189774 AAACCTGCTGATAATCATATGGG - Intergenic
939889542 2:147720349-147720371 CCAACTGCTGAGAATGACTTTGG + Intergenic
940003050 2:148986102-148986124 CTTGCTGCTGATAACGATAAAGG + Intronic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
940621644 2:156120989-156121011 CAAAATGCTAATAGTGATATGGG + Intergenic
941118802 2:161504561-161504583 GGAACTGCTGATAATGGTTTGGG + Intronic
941570359 2:167162117-167162139 CCGAATGCTGATAATGATACAGG - Intronic
941578647 2:167267894-167267916 CAAAATGCTGATAATGATATGGG + Intergenic
943869299 2:192973631-192973653 TAAACTGCTCATAATTATATTGG + Intergenic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
1170304838 20:14926919-14926941 CAAATTGATGATAATTATATTGG + Intronic
1170725164 20:18919682-18919704 CACAATGCTGATAGTGATATGGG + Intergenic
1170801239 20:19592091-19592113 CTAAGTGCTGGTGATGATGTGGG - Intronic
1174631204 20:51959227-51959249 CTTCCTGCAGATAATGATAAAGG + Intergenic
1174857156 20:54057246-54057268 CTAAGTGCTGATAATGGCAGAGG + Intronic
1176657789 21:9603282-9603304 CAAAATGCTGATAATGATATGGG - Intergenic
1177394180 21:20511550-20511572 TAAAATGCTGATAGTGATATGGG - Intergenic
1177614664 21:23501168-23501190 CAAAATGCTGGTAGTGATATGGG + Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1177992730 21:28058182-28058204 CTAAATGCTGACAATGATATGGG + Intergenic
1179156464 21:38855975-38855997 CAAAATGCTGATAATAATAGGGG + Intergenic
1180054430 21:45349946-45349968 GTAACTGCTGGTAATGAGACTGG + Intergenic
1180685776 22:17665327-17665349 CAAAATGCTGACAGTGATATGGG - Intronic
1181505233 22:23351637-23351659 TTAATTGCTCATAGTGATATAGG - Intergenic
1182701442 22:32242727-32242749 ATAACTGCATATAATAATATTGG + Intronic
949451911 3:4195284-4195306 CTAGCTACTGATACTTATATGGG - Intronic
950620908 3:14204599-14204621 CTAACAGCTGGTCATGATAAGGG + Intergenic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
951415242 3:22415103-22415125 TTAAGTGCTGATAATTGTATTGG - Intergenic
952474869 3:33698057-33698079 CTAAGGGCTGAGAAGGATATTGG + Intronic
954040051 3:47878887-47878909 ATAACTACTGAGAATAATATAGG + Intronic
955640575 3:61078653-61078675 CTATTTGCTGATAATATTATTGG - Intronic
955721934 3:61892016-61892038 CTAACTGCTGGTAATGTGCTAGG + Intronic
957889126 3:86332401-86332423 GTAGCTGCTGATAATTATTTTGG - Intergenic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
959027633 3:101258871-101258893 GTAAGTGCTGATAATGTGATAGG + Intronic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
959526566 3:107383949-107383971 ATAAATGGTGATAATGATACTGG + Intergenic
959548626 3:107627699-107627721 CTCACTATTGATAGTGATATAGG + Intronic
959943971 3:112108348-112108370 CTAAGTGCTGGTAAGGATGTGGG + Intronic
961937061 3:130595980-130596002 CCAAGTGCTGATAAGGATGTGGG + Intronic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963181472 3:142361581-142361603 CCAAGTGTTGACAATGATATAGG - Intronic
963539566 3:146567790-146567812 CAAAATGATGATAGTGATATGGG - Intergenic
964520830 3:157564453-157564475 CAAAATGCTGATAGTGATACGGG - Intronic
964797448 3:160515053-160515075 CTGACTGGTGATGCTGATATTGG - Intronic
965433269 3:168615266-168615288 CTCACTGATTATAATGACATAGG + Intergenic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
969149535 4:5157526-5157548 CCAACTGCTGAGAAAGAAATGGG + Intronic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970472447 4:16392468-16392490 CTAACAGCTGGCGATGATATTGG + Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
971546205 4:27890522-27890544 CAAAATGTTGATAGTGATATGGG + Intergenic
972507314 4:39732089-39732111 CTGACTCTTGATAATGATGTTGG - Intronic
972896022 4:43620928-43620950 CAAAATGCTGATAGTAATATGGG - Intergenic
973362614 4:49178900-49178922 CTCACTGCTGAGAATGGTAAGGG - Intergenic
973539345 4:51920632-51920654 CTAAATGCTGATGAGGATATAGG - Intergenic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
974637921 4:64589675-64589697 CAGAATGCTGATAGTGATATGGG + Intergenic
974724105 4:65777061-65777083 CAAAATTCTGATAATGATACGGG + Intergenic
975891904 4:79039754-79039776 CAGACTGCTTATATTGATATTGG + Intergenic
976422117 4:84857737-84857759 TTATCTGCTGAGAATGATAGAGG - Intronic
976576451 4:86677763-86677785 CTAATTTCTGGTAATGTTATTGG + Intronic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
978834532 4:113132860-113132882 CTACCTGCTGATATTGATTATGG + Intronic
979037665 4:115746094-115746116 CTATCCAATGATAATGATATTGG + Intergenic
979060987 4:116059935-116059957 CAAAGTGCTGATAGTGATGTGGG - Intergenic
980572349 4:134637233-134637255 CTAACTGATGGTGATGATATTGG + Intergenic
981111849 4:140943888-140943910 CTAATTGGTGATAATGCTATAGG + Intronic
981391464 4:144196361-144196383 CAAAATGCTGATAGTGATACAGG + Intergenic
981503193 4:145474189-145474211 CAAAATGCTAATAGTGATATGGG - Intergenic
981842887 4:149132918-149132940 TAAAATGCTGATAGTGATATGGG + Intergenic
983320427 4:166190070-166190092 GAAAATGCTGATAATGATATGGG + Intergenic
983379032 4:166967892-166967914 CAAAATGCTGATAGTGATGTGGG + Intronic
983660360 4:170125563-170125585 TAAAATGCTGATAATGATATTGG + Intergenic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
983915022 4:173282537-173282559 CTAACTGCTGTTAGGGAGATTGG + Intronic
984131358 4:175879139-175879161 CAAAATGCTAATAATGATATGGG - Intronic
985417621 4:189752804-189752826 CAAAATGCTGATAATGATATGGG + Intergenic
986537426 5:8805375-8805397 CAAAATGCTGATAGTAATATGGG + Intergenic
986727945 5:10613607-10613629 CTAACTGCACAGAATCATATGGG + Intronic
986911693 5:12565592-12565614 CAAAATGTCGATAATGATATTGG - Intergenic
986991813 5:13562777-13562799 CTAATTGCTGACAAGAATATAGG + Intergenic
987615805 5:20273019-20273041 CTATATGCTGATAATCATTTAGG + Intronic
988038849 5:25861985-25862007 CAAAATGCTGATAGTAATATGGG - Intergenic
988311768 5:29568194-29568216 GCCACTGCTGATAAGGATATCGG - Intergenic
988456307 5:31390007-31390029 CAAAATGCTAATAGTGATATGGG - Intergenic
989324266 5:40172716-40172738 CTAACTGCAAATAAAGACATTGG + Intergenic
989817323 5:45751751-45751773 CAAAATGCTGATAGTGATAATGG - Intergenic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
990919716 5:60948930-60948952 CCAAGTGTTGATAAGGATATAGG - Intronic
991186487 5:63814842-63814864 CAAAATGCTGATAGTGACATGGG + Intergenic
993001036 5:82380593-82380615 CAAAATGCTGATAATGATATGGG - Intronic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
994945915 5:106391502-106391524 GTAATAGCTGATAGTGATATAGG - Intergenic
995964952 5:117894235-117894257 TTTACTCCTGAGAATGATATGGG + Intergenic
996914375 5:128694627-128694649 CTCACTGATGATAATGACAATGG - Intronic
996945664 5:129064068-129064090 CTAATACCTGCTAATGATATGGG + Intergenic
999519498 5:152336369-152336391 CTGCCTGCTGATAATAATAATGG - Intergenic
999990304 5:157043929-157043951 GTAACTGGTGACAATGCTATAGG + Intronic
1000609540 5:163359281-163359303 CAAAATGCTGATAGTGATAATGG + Intergenic
1000768416 5:165319765-165319787 CAAAAAGCTGATAGTGATATGGG - Intergenic
1002117085 5:176971032-176971054 GTAACTGCTGCTAATTATCTTGG - Intronic
1003798236 6:9630197-9630219 CCAAATGCTGATAGTGACATGGG + Intronic
1005200087 6:23334866-23334888 TTAACTGCTGGTAATGAGAAAGG + Intergenic
1006573995 6:35030233-35030255 CTAACTGCAGACAAAAATATTGG + Intronic
1007540491 6:42639019-42639041 CTAACTGCTTATAATCTAATTGG + Intronic
1009635004 6:66253751-66253773 CCAAATGCTGATAATGATATGGG - Intergenic
1009732082 6:67621728-67621750 AAAAATACTGATAATGATATGGG + Intergenic
1009892093 6:69697613-69697635 ATAACTTCTGATAATCATAAAGG - Exonic
1010082537 6:71880986-71881008 CTAGATGCTGACAATGAAATTGG - Intergenic
1010226169 6:73491441-73491463 CAAACTGATAAAAATGATATAGG - Intronic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1012084365 6:94805243-94805265 CAAAGTCCTTATAATGATATAGG - Intergenic
1012120993 6:95366685-95366707 CAAAATACTGATAGTGATATGGG - Intergenic
1012191555 6:96286748-96286770 CTCAGTGCTGAAACTGATATAGG + Intergenic
1012569001 6:100699691-100699713 CAAAATGCTGATAATGATTTGGG + Intronic
1012765499 6:103362467-103362489 CAAAATGCTCATAGTGATATGGG + Intergenic
1013890608 6:115021850-115021872 CAAAATGCTGATAATGATATGGG - Intergenic
1014606977 6:123487811-123487833 CTAAGTGCTGAGAAATATATTGG - Intronic
1015034600 6:128638357-128638379 TTAACTGCTCTTAAGGATATGGG + Intergenic
1015061907 6:128976388-128976410 CTAGCTGGTGATAATGATTTGGG + Intronic
1015239511 6:131007621-131007643 CAAAATGCTGATAGTAATATGGG + Intronic
1015753757 6:136587668-136587690 CTGACTGCTGTTAAGGATGTTGG - Intronic
1016291562 6:142533912-142533934 ATGGCTGCTGATAATGTTATAGG - Intergenic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1019969261 7:4526979-4527001 CTTAGAGCTGAAAATGATATTGG + Intergenic
1020933269 7:14427337-14427359 CAAACTGCTGATAGTGATATGGG - Intronic
1021160372 7:17265064-17265086 ATAAGTGTTGATAAGGATATGGG - Intergenic
1022947858 7:35305209-35305231 CAAACTGCTTATAATAATGTGGG + Intergenic
1023253448 7:38290249-38290271 CTAATTGCTGACACTGATATGGG + Intergenic
1024383614 7:48726149-48726171 CAATATGCTGATAATGATATGGG - Intergenic
1024546317 7:50523670-50523692 TTAACAGCTGACAAAGATATTGG + Intronic
1027600872 7:80239063-80239085 GTTACTGCTAAAAATGATATTGG - Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1033320658 7:140336643-140336665 CTATCTGCTGAATATAATATAGG - Intronic
1034142039 7:148829208-148829230 CTTTCTGCTGATAATGACAATGG + Intronic
1034510823 7:151533198-151533220 CAAAATGCTGATAATGATATGGG - Intergenic
1034708086 7:153164466-153164488 TTAACTGCTGATGAAGACATAGG + Intergenic
1035548212 8:499896-499918 CTAAGTGCTGCTCATGGTATGGG + Intronic
1036761477 8:11512347-11512369 TTACGTGCTTATAATGATATTGG - Intronic
1037433604 8:18840209-18840231 TTAGCTGCTGAGAATGATGTGGG - Intronic
1037596726 8:20360550-20360572 CAATCTGCTGATAATGGTCTTGG + Intergenic
1043225604 8:77725758-77725780 CTATCTGCTGATATTGAGCTTGG - Intergenic
1043694665 8:83203887-83203909 CAAAATGCTGATGGTGATATGGG + Intergenic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044127104 8:88472209-88472231 CAAAATGCTGAGAGTGATATGGG - Intergenic
1045730431 8:105232663-105232685 CCAAATGCTGGCAATGATATGGG - Intronic
1045849198 8:106673177-106673199 CAAAATGCTGATAGTGATAATGG + Intronic
1046134129 8:110004471-110004493 CAAAATGCTGATAGTGATGTGGG - Intergenic
1046151855 8:110237727-110237749 CTAAATGCTGGTAAGGATGTGGG - Intergenic
1046571603 8:115973137-115973159 AAAAGTGCTGATAATCATATAGG + Intergenic
1046668917 8:117036246-117036268 CAAAATGCTGACAGTGATATGGG - Intronic
1047915867 8:129583202-129583224 CAGACAGCTGTTAATGATATCGG - Intergenic
1048569227 8:135637424-135637446 CTAACTGCTTATTATGTGATAGG - Intronic
1048699932 8:137077441-137077463 CAAAATGTTGATAATGATATGGG + Intergenic
1048726231 8:137388068-137388090 CACAATGCTGATAGTGATATGGG - Intergenic
1048806452 8:138245905-138245927 CAAATTGCTGATAGTGATATGGG + Intronic
1050897368 9:10900201-10900223 CAAAATGATGATAGTGATATGGG - Intergenic
1051262997 9:15283783-15283805 ATAACTGATGCTAAGGATATTGG + Intronic
1051569089 9:18535343-18535365 CAAAATGCTGATAGTGATACAGG - Intronic
1051712439 9:19945768-19945790 CTAGCTGCTGATAATTAAAATGG + Intergenic
1052220715 9:26018288-26018310 TAAAATGCTGATAATGATATGGG - Intergenic
1052635430 9:31097742-31097764 CCAAATGCTGACAATGATATAGG + Intergenic
1052980374 9:34444044-34444066 CCAAGTGGGGATAATGATATGGG - Intronic
1053369888 9:37551855-37551877 CTAACTGCTTATAGTAAAATGGG - Intronic
1055174510 9:73300395-73300417 CAAAATGCTGATAATGATACGGG - Intergenic
1057285435 9:93749742-93749764 CAAACTGCTGATAGTGATATGGG - Intergenic
1059570175 9:115425833-115425855 CTAACTGCTGATAATGATATGGG - Intergenic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1059582435 9:115566408-115566430 CAAAATGCTGATAATGATACAGG + Intergenic
1061671661 9:132192193-132192215 CTGACAGCTGATAATGTCATGGG - Intronic
1203635517 Un_KI270750v1:106856-106878 CAAAATGCTGATAATGATATGGG - Intergenic
1188053064 X:25510192-25510214 CAAAATGCTGATAATGATAATGG - Intergenic
1188464604 X:30465685-30465707 CTAACTGCAAATAAAGCTATTGG - Intergenic
1189071390 X:37867288-37867310 CAGAATGCTGATAGTGATATGGG - Intronic
1189112274 X:38304028-38304050 CTATGTGCTGCTAATAATATAGG - Intronic
1189637292 X:43024275-43024297 CAAAATGCTGATAATGATATGGG - Intergenic
1190369664 X:49728282-49728304 CTGTTTGCTGATAATGTTATGGG - Intergenic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1192866881 X:75143376-75143398 CAAAATGCTGATAATGATAATGG - Intronic
1192934990 X:75849954-75849976 AAAAATGCTGATAATGATATGGG - Intergenic
1193232355 X:79062706-79062728 CACACTGCTGATAAAGACATTGG - Intergenic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1193628088 X:83844291-83844313 CTAAATGCTGATAAAAATATGGG - Intergenic
1194064096 X:89240894-89240916 CAAAATGCTGATAGTGATAGGGG + Intergenic
1197295499 X:124714014-124714036 ATAATTGCTGTTAATGATAATGG + Intronic
1197385343 X:125795037-125795059 CAAAATGCTGATAGTAATATGGG + Intergenic
1197869998 X:131055500-131055522 CTAACTCCAGAAAATAATATAGG + Intergenic
1199156840 X:144559771-144559793 CTAAATGGTGTTATTGATATGGG - Intergenic
1200718271 Y:6574993-6575015 CAAAATGCTGATAGTGATAGGGG + Intergenic