ID: 1059570643

View in Genome Browser
Species Human (GRCh38)
Location 9:115430824-115430846
Sequence GTGGCAGGTGGGAGACATTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 497
Summary {0: 1, 1: 0, 2: 3, 3: 48, 4: 445}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059570643_1059570648 -10 Left 1059570643 9:115430824-115430846 CCCCAATGTCTCCCACCTGCCAC 0: 1
1: 0
2: 3
3: 48
4: 445
Right 1059570648 9:115430837-115430859 CACCTGCCACAAATGTGTCCTGG 0: 1
1: 0
2: 0
3: 12
4: 147
1059570643_1059570652 -3 Left 1059570643 9:115430824-115430846 CCCCAATGTCTCCCACCTGCCAC 0: 1
1: 0
2: 3
3: 48
4: 445
Right 1059570652 9:115430844-115430866 CACAAATGTGTCCTGGTAGGTGG 0: 1
1: 0
2: 2
3: 13
4: 142
1059570643_1059570650 -6 Left 1059570643 9:115430824-115430846 CCCCAATGTCTCCCACCTGCCAC 0: 1
1: 0
2: 3
3: 48
4: 445
Right 1059570650 9:115430841-115430863 TGCCACAAATGTGTCCTGGTAGG 0: 1
1: 0
2: 1
3: 8
4: 104
1059570643_1059570653 6 Left 1059570643 9:115430824-115430846 CCCCAATGTCTCCCACCTGCCAC 0: 1
1: 0
2: 3
3: 48
4: 445
Right 1059570653 9:115430853-115430875 GTCCTGGTAGGTGGTGTTGCTGG 0: 1
1: 0
2: 2
3: 17
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059570643 Original CRISPR GTGGCAGGTGGGAGACATTG GGG (reversed) Intergenic
900161399 1:1225618-1225640 GTGGCAGGTGGGGCACCTGGTGG + Intronic
900887127 1:5423082-5423104 GTGGCAGGTGGGAGACAGCCTGG - Intergenic
901641038 1:10693210-10693232 GAGGCAGGTGGGAGACAGTCCGG + Intronic
902176293 1:14653398-14653420 GGGGCCCGTGGGAGACAATGGGG + Intronic
903046755 1:20570085-20570107 GTAGCAGGTGGGAGAAATCAGGG - Intergenic
904307350 1:29598805-29598827 GGGGCATGTGGGTGACCTTGGGG + Intergenic
904396388 1:30225147-30225169 GGGGCAGGTGAGTGACCTTGGGG - Intergenic
904396417 1:30225295-30225317 GGGGCAGGTGGGTGACCTTGGGG - Intergenic
905544954 1:38790356-38790378 GGGGCAGGACAGAGACATTGAGG - Intergenic
905668069 1:39774534-39774556 GAGTCAGGTGGGAGACACTCCGG - Intronic
905857644 1:41324666-41324688 GTGTCAGGTGAGAGACAGAGGGG + Intergenic
906745995 1:48222580-48222602 GTGGCAGTTGGGAGAAAAGGAGG + Intergenic
907301590 1:53490247-53490269 GAGGAAGGTGGGAGACAGGGTGG - Intergenic
907874157 1:58469720-58469742 GTGGCAGGGAGAAGCCATTGGGG + Intronic
908003368 1:59703508-59703530 GTGGTAGCTGGGTGACATGGTGG - Intronic
908177136 1:61566711-61566733 GGGGCAGGTGGGAGGTATTTGGG - Intergenic
908210933 1:61899037-61899059 GTGGTAGGTGGGAAGCAGTGAGG + Intronic
908226421 1:62060623-62060645 GTGGTAGGTGGGAGGGAGTGAGG + Intronic
909372309 1:74898088-74898110 GTGTCAGGTGAGACACAATGAGG - Intergenic
910652933 1:89589376-89589398 ATGGAAGGTGGGAGAAATGGAGG + Intronic
910698286 1:90045306-90045328 GAGGCATGAGGGAGACAATGGGG + Intergenic
911080599 1:93925790-93925812 GTGGCTGGTGGGAGTGAGTGGGG + Intergenic
914934977 1:151970787-151970809 GGGGCAGGTGGGGGGCATTGGGG + Intergenic
915101966 1:153507295-153507317 GTGGGAGGAGGGAGACATGGGGG - Intergenic
915302780 1:154961300-154961322 GGGGCAGGTGTCACACATTGAGG - Intronic
915476237 1:156154426-156154448 GTGGCAGGGGTGGGGCATTGGGG - Intronic
915972690 1:160365558-160365580 GGGGCAGGTGGGGGAGCTTGGGG + Intergenic
917968013 1:180190674-180190696 CTGGCAGCTGGGAGCCAGTGGGG - Intronic
918440921 1:184566329-184566351 TTTGCAGGTTGGAGACATTAAGG + Intronic
918659094 1:187067320-187067342 GTGCCAGGTGGGAGGCAGGGTGG + Intergenic
919144301 1:193613870-193613892 GTGGAAGGTGGCAGAGATAGTGG + Intergenic
919773621 1:201179028-201179050 GTGGGTGGGTGGAGACATTGGGG - Intergenic
920569545 1:207006204-207006226 GTGGCAGGATGGTGACAGTGAGG + Intergenic
920615318 1:207486600-207486622 GTGGAAGATGGGAGTCAATGAGG + Intronic
920737323 1:208544688-208544710 TGGGGAGGTGGGAGACACTGAGG + Intergenic
920831862 1:209472670-209472692 GTAAAAGGTGGGAGACAGTGGGG + Intergenic
921299461 1:213736639-213736661 CTGGGAGGTGGGAATCATTGGGG + Intergenic
921685306 1:218082982-218083004 GGGGCTGGTGGGAGTCAGTGGGG - Intergenic
1063160764 10:3416428-3416450 GTGGGAGTTGGGAGCCATGGAGG + Intergenic
1063371299 10:5524665-5524687 GCGGCAGGTGGGAGACGGGGAGG + Exonic
1063881673 10:10538239-10538261 GAGGCAGGAAGGAGACATGGGGG - Intergenic
1064261300 10:13788431-13788453 GGGCCATGTGGGAGGCATTGGGG - Intronic
1064895359 10:20229198-20229220 GAGACAGGAGGGAGAAATTGAGG + Intronic
1065026387 10:21542933-21542955 GTGGGATGTGGGTGACATTAAGG + Intronic
1065447518 10:25818785-25818807 GTACGAGATGGGAGACATTGGGG - Intergenic
1067091990 10:43271840-43271862 CTGCCAGGTGGGAGACATGAAGG - Intergenic
1068939324 10:62665246-62665268 GTGGGAGGAGAGAAACATTGGGG - Intronic
1069359950 10:67630627-67630649 GGGACAGGTGGGAGACACTATGG + Intronic
1069489348 10:68848143-68848165 GTGCCAGGTGGGAGATAGTGAGG + Intronic
1070916683 10:80159620-80159642 GTGGCAGGTGGGAGATTTTGGGG - Intronic
1071108004 10:82121256-82121278 CTGGGAGGTGGGTGAAATTGAGG - Intronic
1071518660 10:86315593-86315615 GTGGCTGGAAGGAGGCATTGTGG - Intronic
1072010270 10:91297185-91297207 GTAGGAAGTGGAAGACATTGGGG + Intergenic
1073301792 10:102475419-102475441 GTGGCAGGTGGGATACGTTTTGG + Intronic
1073457618 10:103647126-103647148 GTGACAGCTGGGACTCATTGGGG - Intronic
1073509902 10:104036387-104036409 CTGGCAGGTGGGGGTCAGTGGGG + Intronic
1074211602 10:111340369-111340391 GTGGCAGGAGTGAGAGAGTGAGG + Intergenic
1074483811 10:113854138-113854160 GTGGCAGGTGGGGGGCGGTGAGG - Intronic
1075193883 10:120337582-120337604 GGGACAGGTGGGACACCTTGGGG + Intergenic
1075799144 10:125141997-125142019 GGGGCTGGTGGGACACAGTGTGG + Intronic
1076342292 10:129757917-129757939 GTGGCAGGAGGGTGACTTTGGGG - Intronic
1077239334 11:1502463-1502485 GTGCCTGGTGGGAGTCATGGGGG - Intergenic
1077288939 11:1780008-1780030 GTAGGGGGTGGGAGACATGGGGG + Intergenic
1077324690 11:1958687-1958709 GAGGCCTGTGGGAGACATGGGGG - Intronic
1077373585 11:2195006-2195028 GTGGCAGGTGGCAGGCATGCTGG + Intergenic
1078438800 11:11347131-11347153 TTGGCAGCTGGGGGAAATTGAGG - Intronic
1078530031 11:12130183-12130205 GTGGGGAGTGGGAGACAATGGGG + Intronic
1078855599 11:15204464-15204486 GTGGAGGGTGGGAGAGATTAAGG - Intronic
1081162536 11:39767521-39767543 ATGGCAGATCGGAGACATGGTGG - Intergenic
1081507759 11:43735863-43735885 GTGGCAGGAGAGAGAGATCGAGG + Intronic
1082095438 11:48125972-48125994 GTGGCAGGTGGGAGGCTCTCGGG + Intronic
1082796480 11:57381508-57381530 GGAGCTGGTGGGAGACAATGGGG + Intergenic
1082989000 11:59191352-59191374 GGGGGAGGCGGGAGAGATTGAGG - Intronic
1083615211 11:64022743-64022765 GTGGAAGGTGGGAGACTTCCTGG + Intronic
1083616649 11:64029554-64029576 GTGGCAGGTGGAAGCAAATGGGG - Intronic
1084505357 11:69563411-69563433 GTGTCAGGAGATAGACATTGAGG - Intergenic
1085409381 11:76282299-76282321 GGGGCATGTGGGGGACAGTGAGG + Intergenic
1086791072 11:91038703-91038725 GAGGCAGGAGGGAGAAATGGAGG + Intergenic
1088174772 11:107039999-107040021 GTGGGAGGAGGGAGAGAATGAGG + Intergenic
1088711756 11:112514590-112514612 TTGGCTGCTAGGAGACATTGTGG + Intergenic
1089237826 11:117047953-117047975 ATGGCAGGTAGGACACACTGAGG - Intronic
1089906164 11:122041032-122041054 TTGGCATGTGGGTGAGATTGGGG + Intergenic
1090415068 11:126534983-126535005 GTGGCTGGTGGGAGGAAGTGTGG + Intronic
1202807669 11_KI270721v1_random:13864-13886 GAGGCCTGTGGGAGACATGGGGG - Intergenic
1091588045 12:1827257-1827279 GTCCCAGTTGGGAGACACTGGGG + Intronic
1091867773 12:3856697-3856719 GTGGAAGATGGAAGACACTGTGG + Intronic
1092756627 12:11769766-11769788 CGGGAAGGTGGAAGACATTGAGG + Intronic
1093214549 12:16347776-16347798 GTGGCAGATGGAAGACTTGGGGG + Exonic
1093773008 12:23039155-23039177 GTGGCAGGAGAGAGAGAGTGAGG + Intergenic
1095274161 12:40260047-40260069 GTGGAGGGTGGAAGCCATTGAGG - Intronic
1095386162 12:41653155-41653177 CTGGCAGTGGGGAGCCATTGTGG + Intergenic
1096151108 12:49313406-49313428 GGGGCAGGGGGGATACTTTGAGG - Intergenic
1096238184 12:49943734-49943756 GAGGCAGCTGGGAGCCATTGTGG - Intergenic
1096685826 12:53287771-53287793 GTGGAAGGAGGGAGAAAATGAGG - Intronic
1097492576 12:60289585-60289607 GTGGCAGGTAAGAGATAGTGAGG - Intergenic
1099258549 12:80346780-80346802 ATGGCATTTGGGAGACATTTGGG + Intronic
1100715749 12:97303388-97303410 GTGGCATGTGGAAGGCCTTGTGG + Intergenic
1101675421 12:106912668-106912690 GAGGCAGCTGGGAGAAAGTGTGG - Intergenic
1102450414 12:113037792-113037814 GAGGCAGGTAGAAGACAGTGAGG - Intergenic
1102687784 12:114737568-114737590 TTTACAGGTGGGAGACATTGAGG + Intergenic
1103155610 12:118682141-118682163 GTGGGAGGAGGGAGAAATTAGGG + Intergenic
1103362221 12:120361318-120361340 GAGGAAGGTGGGAGAAGTTGTGG - Intronic
1103552614 12:121747859-121747881 GTAGAAGGTGGGAGGCACTGGGG + Intronic
1103552628 12:121747901-121747923 GTAGAAGGTGGGAGGCACTGGGG + Intronic
1103552642 12:121747943-121747965 GTAGAAGGTGGGAGGCACTGGGG + Intronic
1103552656 12:121747985-121748007 GTAGAAGGTGGGAGGCACTGGGG + Intronic
1103552670 12:121748027-121748049 GTAGAAGGTGGGAGGCACTGGGG + Intronic
1103552684 12:121748069-121748091 GTAGAAGGTGGGAGGCACTGGGG + Intronic
1103552712 12:121748151-121748173 GTAGAAGGTGGGAGGCACTGGGG + Intronic
1104777394 12:131398843-131398865 CTGGCAAGTGAGAGACAGTGAGG + Intergenic
1104862745 12:131932959-131932981 GCGGCAGGTGCGAGAGAGTGAGG + Intronic
1104896960 12:132169228-132169250 GTGGCAGGGGGGAGACAGCGGGG + Intergenic
1104896986 12:132169296-132169318 GTGGCAGGGGGGAGACAGCGGGG + Intergenic
1104896999 12:132169331-132169353 GTGGCAGGGGGGAGACCTCAGGG + Intergenic
1105345698 13:19570383-19570405 GAGGCAGGTGGGATCCCTTGAGG + Intergenic
1105790026 13:23789723-23789745 CCGGCAGGTGGGAGAAACTGAGG - Intronic
1106578729 13:30999779-30999801 GAGGCAGGTGGAAGGCAGTGGGG + Intergenic
1108090155 13:46841069-46841091 GTGGCAGGTGAGAGAGAGCGTGG - Intronic
1108367618 13:49731494-49731516 GTGGAAAGTGGGAGAGGTTGTGG + Intronic
1110342514 13:74409452-74409474 GTGTCAGGTGAGACACAATGAGG + Intergenic
1110825805 13:79970411-79970433 GTGGCAGGTGCGAGAGAGAGAGG + Intergenic
1112917516 13:104569671-104569693 CTGGCAGGAGGAAGACCTTGTGG + Intergenic
1113034986 13:106038580-106038602 GTGGCAGGGGAGAGAGAGTGTGG - Intergenic
1115002907 14:28442881-28442903 GTGGGAGTTGGGAGACAGTGTGG + Intergenic
1115089505 14:29557019-29557041 GTAGCAGGTGTGAAACACTGAGG - Intergenic
1118502130 14:66371645-66371667 GTGGCAGGAGAGAGAGAGTGAGG + Intergenic
1118672058 14:68139649-68139671 GGTTCAGGTGGGAGAAATTGTGG - Intronic
1118765507 14:68906889-68906911 GAGGCAGGAGGGTCACATTGAGG + Intronic
1118883184 14:69845826-69845848 GTGGCAGGTGGAAGCCAGTCAGG + Intergenic
1119512387 14:75221874-75221896 GAGCCAGGAGGGAGACAGTGGGG + Intergenic
1120004174 14:79338124-79338146 ATGGGAGTTGGGAGACTTTGAGG + Intronic
1120219620 14:81717472-81717494 GTGGCAGGTGGGAGTCAGGAAGG + Intergenic
1121384908 14:93511087-93511109 GTGGCAGGAGGGAGAGGTGGTGG + Intronic
1122631423 14:103109312-103109334 GAGGGAGGAGGGAGACATGGGGG - Intronic
1122631437 14:103109348-103109370 GAGGGAGGAGGGAGACATGGGGG - Intronic
1122631451 14:103109384-103109406 GAGGGAGGAGGGAGACATGGGGG - Intronic
1122631465 14:103109420-103109442 GAGGGAGGAGGGAGACATGGGGG - Intronic
1122631479 14:103109456-103109478 GAGGGAGGAGGGAGACATGGGGG - Intronic
1122631493 14:103109492-103109514 GAGGGAGGAGGGAGACATGGGGG - Intronic
1122631521 14:103109565-103109587 GAGGGAGGAGGGAGACATGGGGG - Intronic
1122631535 14:103109601-103109623 GAGGGAGGAGGGAGACATGGGGG - Intronic
1122631549 14:103109637-103109659 GAGGGAGGAGGGAGACATGGGGG - Intronic
1122646097 14:103195207-103195229 GTGGCAGGAGAGAGACAGTGGGG - Intergenic
1122652044 14:103231460-103231482 GTGCGAGGTGGGAGAGACTGAGG + Intergenic
1123627485 15:22237914-22237936 GTGGCAGGAAGGGGACATTTGGG - Intergenic
1126388659 15:48121141-48121163 GTGGCCCTTGGGAGACGTTGGGG - Exonic
1126664896 15:51067364-51067386 GTGGCAGGTGGTGGAAATTTGGG - Intronic
1126967356 15:54070114-54070136 ATTGCCGGTGGGAGACATTGTGG - Intronic
1127703443 15:61524641-61524663 GTGGAATGTGGGAGTCATTATGG - Intergenic
1128627242 15:69222284-69222306 ATTGCAGGTGGGAGGCATTCTGG + Intronic
1128775867 15:70319910-70319932 GGGTAAGGTGGGATACATTGTGG - Intergenic
1129232824 15:74206193-74206215 GGGGCAGGTGGGAGGCAATGGGG - Intronic
1129516122 15:76158842-76158864 GTTCCAGGTGGGAGACTCTGAGG - Intronic
1130008773 15:80130052-80130074 GGGGTAGTTGGGAGCCATTGAGG + Intronic
1130346175 15:83047639-83047661 CTGGCAGATGGGAGAAAGTGTGG - Intronic
1131292645 15:91120283-91120305 GTGGCAGGAGAGAGAGAGTGAGG + Intronic
1131317149 15:91349410-91349432 GTGGCAGGTTGGGGCCACTGGGG + Intergenic
1131681966 15:94732996-94733018 GTGGCAGGTGAGCTAAATTGTGG - Intergenic
1132000486 15:98174475-98174497 GTGGCACCTGGGAGACATGAAGG - Intergenic
1132400217 15:101500568-101500590 GTGGCAGGAGTTGGACATTGTGG - Intronic
1132658098 16:1049629-1049651 GGGGCCGCTGGGAGACACTGTGG + Intergenic
1132691067 16:1182187-1182209 GTGGCAGGTGGGAGGCTCTGCGG + Intronic
1132882440 16:2168362-2168384 GTGGCAGGGGGCAGCCAGTGAGG + Intronic
1133454813 16:5932831-5932853 GTGGCGGGTGTGAGGCACTGGGG - Intergenic
1133527485 16:6619839-6619861 GTGGGAGGAGGGAGACAATCAGG - Intronic
1134131931 16:11655962-11655984 CTGGAAGGTGAGTGACATTGGGG - Intergenic
1134798319 16:17061771-17061793 GTAGCAGGTGGGACTCAGTGAGG + Intergenic
1135951356 16:26917336-26917358 GTGGCAAGTGGCAGCCATTATGG + Intergenic
1136399210 16:30008800-30008822 CTGGCAGGCAGGAGATATTGAGG + Intronic
1137605984 16:49787149-49787171 GTGGCAGGCGGAAGTCAGTGTGG - Intronic
1138112724 16:54337462-54337484 GTGGCAGGGGACAGACTTTGGGG - Intergenic
1138389926 16:56662884-56662906 GGGGCAGGTGGGAGGCATGGTGG + Intronic
1138391873 16:56676117-56676139 GGGGCAGGTGGGAGGCGTGGTGG - Exonic
1138870264 16:60874779-60874801 GTGGTAGGTGGGAGAGATGATGG + Intergenic
1139429750 16:66904794-66904816 TTGGTAGGTGGGTGACATGGGGG - Intergenic
1141300019 16:82806022-82806044 ATGGCAGGTGGGAGGCACTCTGG + Intronic
1141976470 16:87519458-87519480 GTGGCAGGAAGGGGACATTTGGG + Intergenic
1142613835 17:1123962-1123984 GGGGCAGGTGGGAGGCAAGGGGG - Intronic
1142953484 17:3504091-3504113 GTGGGAGGTGGAGGACAGTGGGG - Intronic
1143027850 17:3951565-3951587 GTGGCAGGTGGGAGGCACTGGGG - Exonic
1143735727 17:8910932-8910954 CTGGGAGGTGGGAAACATAGAGG + Intronic
1144265141 17:13561717-13561739 GTGGGAGGTCTGACACATTGTGG - Intronic
1144777571 17:17792538-17792560 GTGATGGGTGGGGGACATTGGGG + Intronic
1147384671 17:40074264-40074286 GTGGCAGGTGGGAGGGCTGGGGG - Exonic
1148395586 17:47305396-47305418 GAAGAAGGTGGGAGACAGTGTGG + Intronic
1148559955 17:48600286-48600308 GTGCTAGGATGGAGACATTGTGG - Intronic
1149409767 17:56393350-56393372 GTGGGAGGTGGGGGCCAGTGAGG - Intronic
1149545433 17:57500077-57500099 GTGGCACGGGGGAGATATTGTGG + Intronic
1150481832 17:65516855-65516877 GTGGGAGGAGGGAGAAAATGGGG + Intergenic
1151184982 17:72357316-72357338 GTGGGAGATGGGAGAGAGTGAGG - Intergenic
1151332848 17:73421235-73421257 GTGGCAGGTGGCAGCCCGTGTGG - Intronic
1151429627 17:74053564-74053586 GTGGCAGGTGGGAGCGAGAGAGG - Intergenic
1152228427 17:79103108-79103130 GGGGCAGGTGGGCGATCTTGGGG + Intronic
1152330913 17:79672581-79672603 GTGGGAGGTGGGCGAGAGTGAGG + Intergenic
1152381230 17:79943271-79943293 GTGGCTGGTGCGAGACACAGCGG + Intronic
1152514820 17:80817069-80817091 TTGGCAGGTGGGTGACTTGGGGG + Intronic
1152647375 17:81475700-81475722 GTGGCAGGTGGGAACGACTGAGG + Intergenic
1152703217 17:81829754-81829776 GTGGGATGTGGAAGACTTTGAGG - Intronic
1152841019 17:82568258-82568280 GTGACAGGCAGGTGACATTGAGG - Intronic
1153151870 18:2105148-2105170 GTGGCATGTGGGAGCCATGAGGG - Intergenic
1153179827 18:2420561-2420583 GTGGCAGGTGTGAGTCAATGAGG + Intergenic
1153621369 18:6981358-6981380 GATGCAGGTGGGAGACTGTGAGG - Intronic
1153758764 18:8310265-8310287 GTGGGAGTGGGGAGACAATGGGG - Intronic
1155438872 18:25841006-25841028 TTGGGAGGAGGGAGGCATTGTGG + Intergenic
1157134341 18:45039314-45039336 GGGGCTGGTGGGAGGCACTGTGG - Intronic
1160701680 19:510576-510598 GTGGCAGGAGGGGGACACTGTGG - Intronic
1161195424 19:2983693-2983715 GAGGGAGGTGGGAGCCATGGAGG + Intronic
1161257329 19:3316595-3316617 GAGGAAGGTGGGAGCCATGGAGG + Intergenic
1161273122 19:3401224-3401246 AAGGCAGGTGGGAGCCATAGAGG + Intronic
1161431254 19:4233592-4233614 AAGGCAGGTGGGAGCCATGGAGG - Intronic
1161477711 19:4495654-4495676 GAGGGAGGTGGGAGCCATGGAGG + Intronic
1161492110 19:4567786-4567808 GAGGCAGGTGGGAGCCATGGAGG - Intergenic
1161503847 19:4633316-4633338 GAGGGAGGTGGGAGCCATAGAGG + Intergenic
1161528010 19:4769409-4769431 GTGGCGGGGGGGAGACACAGAGG - Intergenic
1161596679 19:5154259-5154281 GAGGGAGGTGGGAGCCATGGAGG + Intergenic
1161599192 19:5170523-5170545 GAGGAAGGTGGGAGCCATGGAGG + Intronic
1161619180 19:5289482-5289504 GAGGCAGGTGGGAGCCATGGAGG - Intronic
1161620950 19:5296802-5296824 GAGGAAGGTGGGAGCCATGGAGG + Intronic
1161621396 19:5299174-5299196 GAGGGAGGTGGGAGCCATGGAGG - Intronic
1161650398 19:5480659-5480681 GAGGGAGGTGGGAGCCATTGAGG + Intergenic
1161663843 19:5563195-5563217 GAGGGAGGTGGGAGCCATGGAGG + Intergenic
1161664186 19:5565048-5565070 GAGGGAGGTGGGAGCCATAGAGG - Intergenic
1161740646 19:6019001-6019023 GCGGCAGGAGGCAGACTTTGTGG - Intronic
1161756450 19:6137544-6137566 GAGGGAGGTGGGAGCCATGGAGG + Intronic
1162070074 19:8148008-8148030 GTGGGAGGTGGAGGGCATTGAGG + Intronic
1162139870 19:8579255-8579277 GTGGCAGGTGCTAGACCGTGTGG + Intergenic
1162144558 19:8605693-8605715 CTGGCAGGCGGGAGCCATAGAGG + Exonic
1162304463 19:9863326-9863348 GAGGAAGGTGGGAGCCATGGAGG + Intronic
1162569086 19:11460432-11460454 GAGGAAGGTGGGAGCCATAGAGG - Intronic
1162847908 19:13407974-13407996 GTGGCAGGAGAGAGAGAGTGAGG - Intronic
1162871682 19:13591199-13591221 GAGTCAGGTGGGAGCCATGGAGG + Intronic
1162894663 19:13758000-13758022 GAGGAAGGTGGGAGCCATGGAGG - Intronic
1163170778 19:15529637-15529659 GTGGCAGGAGGAAGGCAGTGGGG + Intronic
1163554009 19:17982497-17982519 GTGGGAGATGGGAGACAGAGGGG - Intronic
1164705007 19:30313532-30313554 GTGGCAGGTAGCAGAGCTTGGGG - Intronic
1165012566 19:32859488-32859510 GTGAGAGGTGAGAGGCATTGGGG - Intronic
1165166767 19:33862621-33862643 GTTACAGGTGTGAGCCATTGTGG - Intergenic
1165733655 19:38162453-38162475 GTGGAAGGTGGCAGAGGTTGAGG - Intronic
1165816396 19:38645043-38645065 GGGGGAGCTGGGAGACAGTGGGG + Intergenic
1165930899 19:39357774-39357796 GTGACAGATGGGAGAGATGGAGG + Intronic
1166119082 19:40674247-40674269 CTGGGAGGTGGGAGACAGAGGGG - Intronic
1166696787 19:44856482-44856504 GTGGCAAGTGGGAGCCGTTGCGG - Intronic
1167425048 19:49425940-49425962 GAGGGAGGAGGGAGACATTTGGG - Intronic
1168334768 19:55591569-55591591 GTGGGAGGTGGTGGACACTGGGG - Exonic
1168367550 19:55801792-55801814 GAGGCAGGCAGGAGAAATTGTGG - Intronic
924998892 2:388151-388173 CTGGCAGGTGGGCACCATTGGGG + Intergenic
925586495 2:5469918-5469940 GTGGCAGGTAGATGACTTTGGGG + Intergenic
926186411 2:10694416-10694438 GGGCCAGGTAGGAGACAATGAGG - Intergenic
927328989 2:21840694-21840716 GTGGCAGGAGAGAGAGACTGCGG - Intergenic
927902041 2:26827448-26827470 GCGGCAGGTGGCAGACTTAGAGG - Intergenic
928435374 2:31251419-31251441 GTAGCAGGTGGGAGGGAGTGGGG + Intronic
929236969 2:39615810-39615832 CTGGGAGGTGGGAGACACAGTGG + Intergenic
929542843 2:42835465-42835487 GAGGCAGAGGGCAGACATTGTGG + Intergenic
929543220 2:42838270-42838292 GAGGCAGAGGGCAGACATTGTGG + Intergenic
929816085 2:45232797-45232819 GTGGAAGGTGAGAGGCAATGTGG + Intergenic
930436952 2:51356453-51356475 GTGGCAGGTAAGAGAACTTGTGG - Intergenic
932144709 2:69307126-69307148 GTGGCAGGTAGGAGGCGCTGCGG + Intergenic
932340601 2:70960753-70960775 GTGGGGGGTGGGAGTTATTGTGG - Intronic
932557331 2:72836119-72836141 GGGGCAGGTAGAAGGCATTGGGG - Intergenic
933723444 2:85412559-85412581 GTGGGAGGAGGGAGAGATTCAGG + Intronic
934019255 2:87928178-87928200 GTGGCAGGAGGGAGAGAATCAGG - Intergenic
934054246 2:88238744-88238766 TTGGCACCTGAGAGACATTGTGG - Intergenic
934611148 2:95737420-95737442 GTAGGAGGTGGGAGAGACTGTGG - Intergenic
935136465 2:100307580-100307602 GTGGCAGGGGAGAGGAATTGGGG + Intronic
935800082 2:106687054-106687076 GTGGCAGGCAAGAGAGATTGTGG + Intergenic
936282256 2:111152333-111152355 TTGGCAGCAGGGAGACACTGTGG - Intronic
936397858 2:112142564-112142586 GGGTCAGGTGGGAGGCACTGAGG + Intronic
936437728 2:112522660-112522682 GAGGCAGACGGGAGACATTCTGG - Intronic
937279321 2:120706463-120706485 GTGGCAGGTGGGGAACCTGGTGG - Intergenic
937927564 2:127178723-127178745 GTGTCTCGTGTGAGACATTGGGG + Intergenic
938292616 2:130158168-130158190 GGAGCAGGTGGGAGGAATTGGGG - Intronic
940716193 2:157227323-157227345 GTGGGGGGTGGGGGGCATTGGGG - Intergenic
940992068 2:160107615-160107637 GAGGCTGGTGGAAGAGATTGAGG - Intronic
941843176 2:170109350-170109372 GTGACTGCTGGGAGACCTTGGGG - Intergenic
942531552 2:176915500-176915522 GAGCCAGGTGGCAGACAGTGGGG - Intergenic
942619208 2:177829777-177829799 GTGGCAGGTGGGATTCTTAGAGG - Intronic
943288104 2:186031401-186031423 GTGTCAGGTGAGATACAATGAGG + Intergenic
943549106 2:189316600-189316622 GTGGGAGGAGGGAGAGAATGAGG + Intergenic
943772754 2:191736325-191736347 TTTACAGGTGGGAGAAATTGAGG - Intergenic
943846563 2:192656216-192656238 GGGGCAGGTGGGAGACTCTCTGG + Intergenic
943931778 2:193863935-193863957 GGGGCAGGTGCGAGTCATTCAGG - Intergenic
944855622 2:203764351-203764373 TTGGCAGGTGGGAGTCTTTTGGG + Intergenic
945387013 2:209213677-209213699 CTGGCAGGTGGGGGGCAGTGAGG - Intergenic
946335144 2:219031021-219031043 ATGGGAGGTGGGGGACACTGAGG + Intronic
946422586 2:219572864-219572886 ATGGCAGGTGGGAGGCATTTGGG + Intronic
948315848 2:237027626-237027648 GTGGCCGGTGGGTGACATGAAGG + Intergenic
948404021 2:237704056-237704078 ACGGCAGATGGCAGACATTGGGG - Intronic
949048907 2:241886521-241886543 GGGGCAGGTGGCAGACCTCGGGG + Intergenic
1170657155 20:18298571-18298593 ATGGCTTGTGGGAGACATGGTGG + Intronic
1170753034 20:19169456-19169478 GTGGCAGGAGGGAGAGTGTGGGG - Intergenic
1171077839 20:22147254-22147276 ATGGCAGGTGGGAGGCCTGGGGG - Intergenic
1171431877 20:25088030-25088052 GTGGCAAGGGGAAGCCATTGAGG - Intergenic
1172595462 20:36148287-36148309 GTGGCAGGACGGAGACAGAGAGG + Intronic
1173866614 20:46316598-46316620 GAGGCAGGTGAGTCACATTGAGG + Intergenic
1174038859 20:47685058-47685080 ATGGCAGGTGGCAGTTATTGTGG + Intronic
1175761257 20:61563399-61563421 GGAGAAGGAGGGAGACATTGGGG - Intronic
1177241231 21:18460613-18460635 CTGGCAGGTGGGAGACCCAGAGG + Intronic
1178357367 21:31920129-31920151 GAGGAAGGAGGCAGACATTGGGG - Intronic
1178363343 21:31968234-31968256 ATGGCACCTGGGAGACATTTGGG - Exonic
1178902840 21:36611438-36611460 GTGGCAGATGGGAGAGGCTGTGG - Intergenic
1179929694 21:44559056-44559078 GTGGCAGTTAGGAGATATTCTGG + Intronic
1179982917 21:44905792-44905814 GAGGCAGCTGGGAGACAGTGAGG - Intronic
1181410306 22:22713684-22713706 GTGCCAGGTGGGTCACATTGAGG - Intergenic
1181531690 22:23520998-23521020 GTGGCTGGTGGGAGTCAGTGGGG - Intergenic
1182059480 22:27386794-27386816 GGGGCAGGTGGCAGAGAATGAGG - Intergenic
1182519810 22:30878916-30878938 GGGGGAAGTAGGAGACATTGGGG + Intronic
1182548443 22:31088831-31088853 GTGGCAGGTGAGTGACAGGGAGG - Intronic
1183194768 22:36345826-36345848 ATGGCAGGTGGGAAGAATTGAGG - Intronic
1183362331 22:37389253-37389275 GGGGCCAGTGGGAGCCATTGTGG - Intronic
1183632525 22:39041968-39041990 CTTGCAGGAGGGAGCCATTGGGG - Intronic
1183949308 22:41343783-41343805 GAGGCAGGTGGGACACATTTGGG + Intronic
1184161915 22:42702065-42702087 GTGGCAGGAGGGAGAGAAAGAGG - Intronic
1184531095 22:45056246-45056268 TAGGCAGGAGGGGGACATTGGGG - Intergenic
1184648823 22:45910382-45910404 GTGGCAGCTGGGAGACACGGTGG + Intergenic
1184735517 22:46395488-46395510 GAGGGAGGTGGGAGCCAGTGTGG - Intronic
1184744110 22:46446164-46446186 CTGGGAGGAGGGAGACAGTGGGG - Intronic
1184751225 22:46487751-46487773 GGTGCAGGTGGGAGGTATTGGGG + Intronic
1185138133 22:49085291-49085313 GTGGCAGTTGGGGGACATTGTGG - Intergenic
950332582 3:12168271-12168293 ATGGGAGGTGGGAGAGATGGAGG + Intronic
950563398 3:13749091-13749113 GAGGAAGGTGGGAGCCATGGAGG - Intergenic
950664094 3:14484428-14484450 GGGGAAGGTGGGAGCCATGGAGG + Intronic
950680115 3:14579524-14579546 TTCACAGGTGGGAGGCATTGTGG + Intergenic
950973704 3:17216663-17216685 GTGGTGGGTGGGAAACATGGAGG - Intronic
951384876 3:22030440-22030462 GTGGCAGGAGGGAGAGAGAGAGG + Intronic
952106308 3:30073688-30073710 GTGGCCGGAGGGAGAAACTGTGG - Intergenic
952388054 3:32857106-32857128 ATGGCAGTTGGGTGACCTTGAGG - Intronic
952879309 3:37973427-37973449 GGGGCAGGTGGGAGCCATCCAGG - Intronic
952981418 3:38739046-38739068 TTGGCAGATGGGAGACTTTCGGG + Intronic
953976023 3:47382013-47382035 GTCGCAGGTGGGGGGCCTTGTGG + Intronic
955411922 3:58661347-58661369 CTGGCTGGTGAGAGACATGGGGG - Intronic
955889822 3:63637950-63637972 GTGGGAGGTGGGAGAGAATCAGG - Intergenic
955978101 3:64497538-64497560 ATGCCAGGTGGGAGACATCCGGG - Intergenic
958622862 3:96583988-96584010 GATGCAGGTGGGAGCCATTCAGG - Intergenic
959376659 3:105595998-105596020 GTGGCAAGTAATAGACATTGAGG - Intergenic
959383990 3:105678526-105678548 GGGGGAGGTGGGAGAGATGGAGG + Exonic
960734913 3:120768361-120768383 GTGCCTGATGGGAGACATTGAGG + Intronic
962555916 3:136551361-136551383 GTGGGAGGTGGGAGAGGTTGAGG - Intronic
964026309 3:152079109-152079131 GTGGCAGGAGAGAGAGAGTGAGG + Intergenic
964623761 3:158739591-158739613 GTGGGAGGTGGGAGGCAGTGGGG + Intronic
964748894 3:160036876-160036898 GTGGCGGCTGGGGGGCATTGGGG - Intergenic
965095051 3:164215696-164215718 CTGGCAGTTCGAAGACATTGTGG - Intergenic
967751855 3:193124298-193124320 GGGGCAGTTGGGAGACACTTTGG + Intergenic
968637937 4:1691997-1692019 GTGGAGGGTGGTAGACACTGGGG - Intergenic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
969376241 4:6765209-6765231 GAGGCAGCTCCGAGACATTGGGG - Intergenic
969480606 4:7445061-7445083 GTGGCAAGAGGGAGGGATTGGGG + Intronic
970073717 4:12194496-12194518 GTGGGAGGTGGGAGGTATTTGGG - Intergenic
970315537 4:14825475-14825497 CTTCCAGGTAGGAGACATTGAGG - Intergenic
971148586 4:24006660-24006682 ATGGCAGGAGAAAGACATTGTGG - Intergenic
972338520 4:38129925-38129947 GTGGCTGTTGGGAGACAATTTGG + Intronic
972434021 4:39014352-39014374 AGGGCAGGTAGAAGACATTGAGG + Intronic
972701861 4:41502052-41502074 GTGGCAGGGGGAAGTCATTGGGG - Intronic
973083216 4:46021801-46021823 GTGACTGGTGTCAGACATTGGGG - Intergenic
974061633 4:57041067-57041089 GTGGCAGGAGGAAGCCAGTGTGG - Intronic
974359364 4:60856378-60856400 GTGGCAGGGGATAGATATTGAGG - Intergenic
974469333 4:62297936-62297958 GTGGCAGGAGAGAGAGAGTGAGG + Intergenic
976194559 4:82520460-82520482 GTGGGGTGTGGGAGAAATTGAGG - Intronic
976673063 4:87674949-87674971 GTGGAAGGTGGAAGACAAAGAGG + Intergenic
977028071 4:91846331-91846353 GGGGGAGCTGGCAGACATTGAGG - Intergenic
978499978 4:109399225-109399247 GTGGGAGGTGGGAGGGTTTGAGG - Intergenic
978699122 4:111621787-111621809 GTGGCAGGTGAGAGAGAGGGTGG + Intergenic
978968109 4:114767830-114767852 GTGGGAGGAGGGAGACAATCAGG + Intergenic
980035767 4:127881190-127881212 GGGGCGGGTGGGAGTAATTGTGG + Intronic
980203817 4:129691712-129691734 GTGGCAGGTGAAAGAGAGTGAGG + Intergenic
980273862 4:130622643-130622665 GTGACAGGAGAGAGAGATTGAGG - Intergenic
980430648 4:132689552-132689574 GTGGCAGGAGAGAGAGAGTGAGG - Intergenic
981555673 4:145990960-145990982 GTGGCAGATGGAAGACAGAGGGG + Intergenic
982901738 4:161013262-161013284 GTGGGAGGAGGGAAATATTGTGG - Intergenic
983833674 4:172363327-172363349 GTGGCAGGTGGGAGGGTTTCAGG - Intronic
983985527 4:174055335-174055357 GTGGAAGGTGGGAGGAAATGAGG - Intergenic
984319090 4:178168336-178168358 GTGGAAGGTGGGAAAAAATGAGG + Intergenic
984944331 4:184959514-184959536 GCTGCAGGTGGGAGGCAGTGGGG - Intergenic
985587998 5:750864-750886 GTGTCAGGCGAGAGACAGTGGGG - Intronic
985602667 5:843331-843353 GTGTCAGGCGAGAGACAGTGGGG - Intronic
987203443 5:15600614-15600636 ATGGGAGGTGGGAAACATAGCGG + Intronic
987300938 5:16597707-16597729 GGGGCATGTGGGAGACATGTTGG - Intronic
987660731 5:20872248-20872270 GTGGCAGTGGGGGGACAATGTGG - Intergenic
987840996 5:23222678-23222700 GTGGCAGGTGGGAGGAAATAGGG + Intergenic
988629933 5:32918011-32918033 GTGGCAGGAGGGAGACGGTTGGG - Intergenic
988762914 5:34333437-34333459 GTGGCAGTGGGGGGACAATGTGG + Intergenic
989810613 5:45668384-45668406 GTGGCAGGAGAGAGAGATTGAGG - Intronic
991398534 5:66229740-66229762 ATGACAGGTGTGAGTCATTGTGG - Intergenic
991608802 5:68429369-68429391 GGGGCAGGATGGAGACATGGGGG - Intergenic
993899613 5:93575587-93575609 GTGACAGGTGGGAGGTAATGGGG - Intergenic
997361720 5:133299470-133299492 CTGGCAGGTGGGAGGCAGGGAGG + Intronic
998018417 5:138751259-138751281 GGGGCTGGTGGGAGGCATTTGGG - Intronic
998054592 5:139063456-139063478 GAGGAACATGGGAGACATTGAGG - Intronic
998208031 5:140173464-140173486 GAAGCAGGTGGGAGACTCTGGGG - Intergenic
998463572 5:142326019-142326041 GTGAGAGGTGGGGGATATTGGGG - Intronic
1000044270 5:157508784-157508806 TTGGTTGGAGGGAGACATTGAGG - Intronic
1000060339 5:157649940-157649962 GTTACAGGTGTGAGCCATTGTGG - Intronic
1001223755 5:169926241-169926263 GTGGCAGGTGAGAGACAATCAGG - Intronic
1001369002 5:171177368-171177390 GAAGCAGGTGGAAGAGATTGTGG - Intronic
1001965812 5:175909129-175909151 ATGGCAGGTGGGGGACATGGAGG - Intergenic
1002251134 5:177930071-177930093 ATGGCAGGTGGGGGACATGGAGG + Intergenic
1003869651 6:10391366-10391388 GGGGCAGGTGGGACCCAGTGAGG + Intergenic
1004021187 6:11776842-11776864 GAGGCAGGAGGGAGCCACTGTGG + Intronic
1004149177 6:13098705-13098727 GTGAGAGGTGGTAGACAATGAGG - Intronic
1004471892 6:15936958-15936980 GTGGTTTGTGGGAGACATTTGGG + Intergenic
1006027804 6:31158425-31158447 GTGGAAGGCGGGAGATCTTGGGG + Intergenic
1006756338 6:36418899-36418921 GTGGCAGGGGGGAGATAGTGTGG + Intronic
1007293097 6:40801816-40801838 GTGGCAGGAGGGAGACTGGGAGG + Intergenic
1007625515 6:43244052-43244074 AAGGCAGGTGGGAGGCATGGAGG - Intronic
1007907147 6:45473261-45473283 TTGGCAGGTGGGAGGAATGGGGG - Intronic
1011534437 6:88360802-88360824 GAGGCAGGTGGGAGACAGGGAGG - Intergenic
1013845655 6:114447814-114447836 GTGGCAGGAGTGAGAGAGTGAGG + Intergenic
1013900370 6:115148501-115148523 GTGGCAGGAGGGAGAAAGGGAGG + Intergenic
1014170762 6:118276842-118276864 TTGGCAAGTGGGATATATTGAGG + Intronic
1016108469 6:140191361-140191383 GTGGCAGGGTGGAGAAATTGAGG + Intergenic
1018356951 6:163027918-163027940 GTGGTTGGTGGGGGACAGTGTGG - Intronic
1018612731 6:165661019-165661041 CAGGCAGGCGGGAGACAGTGAGG - Intronic
1019211823 6:170412834-170412856 GTGGAAGCAGGGAGACAATGAGG - Intergenic
1019605304 7:1907172-1907194 GTGGCAGTGGGGAGATAGTGGGG - Intronic
1020983020 7:15095658-15095680 GTGGTAAGTGGGAAGCATTGAGG + Intergenic
1021299746 7:18957919-18957941 GTAGCATGTGGGAAACATTCAGG + Intronic
1022187708 7:27986664-27986686 GTGGAAAGTGGGAGACAGAGAGG - Intronic
1023555169 7:41414569-41414591 GAGGCAGGAGGGAAACATTTTGG + Intergenic
1023991795 7:45133014-45133036 GTGGCTGGTGGGGGGCAGTGGGG + Intergenic
1024548291 7:50540101-50540123 CTGGCAGCTGGGAGCCATGGGGG - Intronic
1024846093 7:53643954-53643976 TGGGCAGGTGGAAGACAGTGAGG + Intergenic
1025740063 7:64187767-64187789 CTGGCAGCTGTGAAACATTGTGG - Intronic
1025823075 7:64989246-64989268 GTTGCAGGTGTGTGGCATTGTGG - Intronic
1025994446 7:66519012-66519034 GTGGACGGTGGGGGAAATTGGGG + Intergenic
1026158186 7:67845946-67845968 GTGGGTGGTGGGAGCCACTGGGG + Intergenic
1026427971 7:70315582-70315604 CTGGCAGGTGGTTGACAATGTGG - Intronic
1027560095 7:79718748-79718770 GTGGCAGGTGAGAGAGAGAGAGG + Intergenic
1028218342 7:88163055-88163077 GTGGAAGATGGGACACCTTGTGG + Exonic
1028435939 7:90803651-90803673 GTGGCAGTTGTGTGACATGGTGG + Intronic
1028789505 7:94837394-94837416 GTGGGAGGAGGGAGACAATCAGG - Intergenic
1029488411 7:100857097-100857119 GCGGCAGGGAGGAGCCATTGGGG - Exonic
1030147066 7:106367644-106367666 GGGGTAGGTGGGAGGCATGGTGG + Intergenic
1031153748 7:118085148-118085170 ATGGTAGGTGGGAGAAGTTGGGG - Intergenic
1031206650 7:118767488-118767510 GTGACAGGTGAGAGAAGTTGAGG + Intergenic
1031402507 7:121342340-121342362 GTGGCAGGTAGGAGAATGTGAGG - Intergenic
1032282806 7:130518478-130518500 GGAGCAGGTGGGTGGCATTGAGG + Intronic
1033257158 7:139811986-139812008 TTGGGAGCTGGAAGACATTGAGG - Intronic
1034275721 7:149823024-149823046 TTGGCAGATGGGAGACAGAGGGG - Intergenic
1034278447 7:149834942-149834964 GTGGCAGGTGGGAGTCAGGGAGG - Intergenic
1035060223 7:156063513-156063535 TTGCCACGTGGGAGAGATTGCGG + Intergenic
1035412530 7:158656596-158656618 GGGGCAGGTGGGGCACATTCTGG - Exonic
1035418396 7:158707608-158707630 GTTGCAGGTGGGAGCCAAAGTGG - Intergenic
1035639793 8:1176193-1176215 GCGGTAGGTGAGAGACAGTGTGG + Intergenic
1036217984 8:6896787-6896809 GAGGTAGGAGGGAGAAATTGGGG - Intergenic
1037932544 8:22890664-22890686 GTGGCAGGTAGCAGGCAGTGTGG + Intronic
1038125021 8:24663998-24664020 GTGGAAGGTGGGAGAGAATTTGG - Intergenic
1038627366 8:29207081-29207103 GAGGGAGTTGGGAGCCATTGAGG - Intronic
1041215452 8:55595915-55595937 GTGTCAGGTGAGACACAATGAGG - Intergenic
1041776296 8:61526838-61526860 GTGGGAGGTGGGGGACAGTAGGG + Intronic
1042335204 8:67622713-67622735 GAGGGAGGAAGGAGACATTGTGG - Intronic
1042522951 8:69733713-69733735 GTGGCAGGTGAAAGAGAGTGAGG - Intronic
1042837184 8:73089776-73089798 CTGGCATGTGGTAGACATTTAGG - Intronic
1043377715 8:79668955-79668977 GTGGGTGGTGGGGGACAGTGAGG - Intergenic
1044150209 8:88767246-88767268 GTGTCAGGTGAGACACAATGGGG + Intergenic
1044956855 8:97490124-97490146 GTGGTAGGTGAGAGAGAATGAGG - Intergenic
1045649151 8:104326656-104326678 GTGGCAGGTTGCAGACATGGAGG - Intergenic
1046181021 8:110647780-110647802 GAGGCAGGAGGGAGGCATGGAGG + Intergenic
1047950383 8:129928745-129928767 GTGGGAGGTAGTATACATTGTGG - Intronic
1048191053 8:132289550-132289572 CTTGTAGGTGAGAGACATTGAGG - Intronic
1049330246 8:142046605-142046627 GTGGCAGGAGGGAGAGTTGGTGG + Intergenic
1049849133 8:144821409-144821431 CTGGCAGGTGAGAGGCACTGGGG - Intergenic
1049993195 9:1009508-1009530 GTGGCATGTGGGTGACATGCTGG + Intergenic
1051498609 9:17752840-17752862 GTGGGAGGAGGGAGACAATCGGG - Intronic
1053295045 9:36906691-36906713 GGGGCTGGTGGGAGAGCTTGCGG - Intronic
1053543865 9:39002567-39002589 GTGGGAGGAGGGAGAGATTCAGG - Intergenic
1053808295 9:41826064-41826086 GTGGGAGGAGGGAGAGATTCAGG - Intergenic
1054622297 9:67361364-67361386 GTGGGAGGAGGGAGAGATTCAGG + Intergenic
1054750311 9:68898528-68898550 CTGTCACGTGGGAGCCATTGGGG - Intronic
1055824202 9:80304335-80304357 TTGGCAGGTGGCAGACATGGAGG + Intergenic
1056134317 9:83616571-83616593 GTGGCTGTTGGGAGAAAATGGGG - Intergenic
1056732513 9:89178235-89178257 GTTTCAGGTGGGACACCTTGTGG + Exonic
1058420445 9:104828286-104828308 GTGTCAGGAGGGAGGCCTTGGGG + Intronic
1059153911 9:111973179-111973201 GGGGCAGGTGGGGGCCGTTGAGG + Intergenic
1059570643 9:115430824-115430846 GTGGCAGGTGGGAGACATTGGGG - Intergenic
1061386690 9:130294795-130294817 ATGGGAGGGGGAAGACATTGTGG + Intronic
1062526986 9:136981907-136981929 GGGGTGGGTGGGAGACAGTGAGG - Intronic
1185931927 X:4213056-4213078 GTGGCAGGTGAGAGAGTGTGAGG - Intergenic
1186135112 X:6511079-6511101 GTGGGAGGAGGGAGAGAATGAGG + Intergenic
1186269821 X:7874683-7874705 TTGGCAGGTGGCTGCCATTGAGG + Intergenic
1186487714 X:9946388-9946410 GAGGCAGGTGGGAGAGAGTCAGG + Intronic
1187942360 X:24394398-24394420 CTGGCAAGGGGGAGACATGGAGG + Intergenic
1188512967 X:30956854-30956876 GTGACAGAGGGGAGACAATGTGG - Intronic
1188948346 X:36336424-36336446 GTGTCAGGTGAGACACAATGAGG - Intronic
1190227795 X:48559542-48559564 GTGGCAACTGATAGACATTGGGG + Intronic
1190277047 X:48905489-48905511 GTGGCACGTGGAAGGCACTGAGG + Intronic
1190626516 X:52343083-52343105 GGGGAAGGTGGGGGACAGTGAGG + Intergenic
1190701492 X:52992756-52992778 GGGGAAGGTGGGGGACAGTGAGG - Intronic
1192076348 X:68001961-68001983 TTGGCAGGTGGGACATATTTTGG - Intergenic
1193659172 X:84236417-84236439 GTGGCAGGTGTGATGCATGGGGG + Intergenic
1194746556 X:97634852-97634874 GTAGCGGGTGGGAGACGTAGAGG + Intergenic
1196118787 X:112025959-112025981 GTGTCAGGTGAGACACAATGAGG - Intronic
1196433427 X:115652304-115652326 GTAGCTGGTGGGACACATTATGG - Intergenic
1197639293 X:128950414-128950436 GGGGCAGTGGGGAGCCATTGAGG - Intergenic
1198129197 X:133676942-133676964 GTGACAGGAGAGAGACATTGGGG - Intronic
1199086751 X:143636245-143636267 GTGGTAGTTGGGAGACATTAGGG + Intergenic
1199125272 X:144110961-144110983 GTGGCAGGAGGGAGAGAATCAGG + Intergenic
1201438507 Y:13985212-13985234 GTGTCAGGAGGGAGACAGGGGGG - Intergenic
1201446066 Y:14057496-14057518 GTGTCAGGAGGGAGACAGGGGGG + Intergenic