ID: 1059582433

View in Genome Browser
Species Human (GRCh38)
Location 9:115566381-115566403
Sequence AAACCATTCAACAAGTATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059582433_1059582435 4 Left 1059582433 9:115566381-115566403 CCTAGATACTTGTTGAATGGTTT No data
Right 1059582435 9:115566408-115566430 CAAAATGCTGATAATGATACAGG No data
1059582433_1059582438 27 Left 1059582433 9:115566381-115566403 CCTAGATACTTGTTGAATGGTTT No data
Right 1059582438 9:115566431-115566453 CAATGAAATCCAGGCTGAGGTGG 0: 337
1: 983
2: 1447
3: 1738
4: 1383
1059582433_1059582436 18 Left 1059582433 9:115566381-115566403 CCTAGATACTTGTTGAATGGTTT No data
Right 1059582436 9:115566422-115566444 TGATACAGGCAATGAAATCCAGG No data
1059582433_1059582437 24 Left 1059582433 9:115566381-115566403 CCTAGATACTTGTTGAATGGTTT No data
Right 1059582437 9:115566428-115566450 AGGCAATGAAATCCAGGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059582433 Original CRISPR AAACCATTCAACAAGTATCT AGG (reversed) Intergenic
No off target data available for this crispr