ID: 1059582435

View in Genome Browser
Species Human (GRCh38)
Location 9:115566408-115566430
Sequence CAAAATGCTGATAATGATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059582433_1059582435 4 Left 1059582433 9:115566381-115566403 CCTAGATACTTGTTGAATGGTTT No data
Right 1059582435 9:115566408-115566430 CAAAATGCTGATAATGATACAGG No data
1059582432_1059582435 5 Left 1059582432 9:115566380-115566402 CCCTAGATACTTGTTGAATGGTT No data
Right 1059582435 9:115566408-115566430 CAAAATGCTGATAATGATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059582435 Original CRISPR CAAAATGCTGATAATGATAC AGG Intergenic
No off target data available for this crispr