ID: 1059585404

View in Genome Browser
Species Human (GRCh38)
Location 9:115600797-115600819
Sequence GAGAGTGTGAAATGTGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059585402_1059585404 -3 Left 1059585402 9:115600777-115600799 CCTGGAAAGAAGAGCACAGTGAG No data
Right 1059585404 9:115600797-115600819 GAGAGTGTGAAATGTGGAGAAGG No data
1059585399_1059585404 21 Left 1059585399 9:115600753-115600775 CCAAGTCTGAAAGGTATCTTTCC No data
Right 1059585404 9:115600797-115600819 GAGAGTGTGAAATGTGGAGAAGG No data
1059585401_1059585404 0 Left 1059585401 9:115600774-115600796 CCTCCTGGAAAGAAGAGCACAGT No data
Right 1059585404 9:115600797-115600819 GAGAGTGTGAAATGTGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059585404 Original CRISPR GAGAGTGTGAAATGTGGAGA AGG Intergenic
No off target data available for this crispr