ID: 1059586385

View in Genome Browser
Species Human (GRCh38)
Location 9:115611974-115611996
Sequence CAACAGCTAAGGACAGAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059586385_1059586394 12 Left 1059586385 9:115611974-115611996 CCACTCTCTGTCCTTAGCTGTTG No data
Right 1059586394 9:115612009-115612031 GTTGAAGAAGGAAGGAAAAGTGG No data
1059586385_1059586395 30 Left 1059586385 9:115611974-115611996 CCACTCTCTGTCCTTAGCTGTTG No data
Right 1059586395 9:115612027-115612049 AGTGGAGAAATTTGAAAAGATGG No data
1059586385_1059586392 0 Left 1059586385 9:115611974-115611996 CCACTCTCTGTCCTTAGCTGTTG No data
Right 1059586392 9:115611997-115612019 AGGGAGGGAGGAGTTGAAGAAGG No data
1059586385_1059586393 4 Left 1059586385 9:115611974-115611996 CCACTCTCTGTCCTTAGCTGTTG No data
Right 1059586393 9:115612001-115612023 AGGGAGGAGTTGAAGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059586385 Original CRISPR CAACAGCTAAGGACAGAGAG TGG (reversed) Intergenic
No off target data available for this crispr