ID: 1059586390

View in Genome Browser
Species Human (GRCh38)
Location 9:115611985-115612007
Sequence CCTCCCTCCCTCAACAGCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059586390_1059586395 19 Left 1059586390 9:115611985-115612007 CCTTAGCTGTTGAGGGAGGGAGG No data
Right 1059586395 9:115612027-115612049 AGTGGAGAAATTTGAAAAGATGG No data
1059586390_1059586393 -7 Left 1059586390 9:115611985-115612007 CCTTAGCTGTTGAGGGAGGGAGG No data
Right 1059586393 9:115612001-115612023 AGGGAGGAGTTGAAGAAGGAAGG No data
1059586390_1059586394 1 Left 1059586390 9:115611985-115612007 CCTTAGCTGTTGAGGGAGGGAGG No data
Right 1059586394 9:115612009-115612031 GTTGAAGAAGGAAGGAAAAGTGG No data
1059586390_1059586396 25 Left 1059586390 9:115611985-115612007 CCTTAGCTGTTGAGGGAGGGAGG No data
Right 1059586396 9:115612033-115612055 GAAATTTGAAAAGATGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059586390 Original CRISPR CCTCCCTCCCTCAACAGCTA AGG (reversed) Intergenic
No off target data available for this crispr