ID: 1059586392

View in Genome Browser
Species Human (GRCh38)
Location 9:115611997-115612019
Sequence AGGGAGGGAGGAGTTGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059586385_1059586392 0 Left 1059586385 9:115611974-115611996 CCACTCTCTGTCCTTAGCTGTTG No data
Right 1059586392 9:115611997-115612019 AGGGAGGGAGGAGTTGAAGAAGG No data
1059586384_1059586392 1 Left 1059586384 9:115611973-115611995 CCCACTCTCTGTCCTTAGCTGTT No data
Right 1059586392 9:115611997-115612019 AGGGAGGGAGGAGTTGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059586392 Original CRISPR AGGGAGGGAGGAGTTGAAGA AGG Intergenic
No off target data available for this crispr