ID: 1059586395

View in Genome Browser
Species Human (GRCh38)
Location 9:115612027-115612049
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059586385_1059586395 30 Left 1059586385 9:115611974-115611996 CCACTCTCTGTCCTTAGCTGTTG No data
Right 1059586395 9:115612027-115612049 AGTGGAGAAATTTGAAAAGATGG No data
1059586390_1059586395 19 Left 1059586390 9:115611985-115612007 CCTTAGCTGTTGAGGGAGGGAGG No data
Right 1059586395 9:115612027-115612049 AGTGGAGAAATTTGAAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059586395 Original CRISPR AGTGGAGAAATTTGAAAAGA TGG Intergenic
No off target data available for this crispr