ID: 1059586396

View in Genome Browser
Species Human (GRCh38)
Location 9:115612033-115612055
Sequence GAAATTTGAAAAGATGGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059586390_1059586396 25 Left 1059586390 9:115611985-115612007 CCTTAGCTGTTGAGGGAGGGAGG No data
Right 1059586396 9:115612033-115612055 GAAATTTGAAAAGATGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059586396 Original CRISPR GAAATTTGAAAAGATGGAAG AGG Intergenic
No off target data available for this crispr