ID: 1059593670

View in Genome Browser
Species Human (GRCh38)
Location 9:115692717-115692739
Sequence TCTAAGGCCTCTCTTCTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059593670_1059593673 -7 Left 1059593670 9:115692717-115692739 CCTCTTAGAAGAGAGGCCTTAGA No data
Right 1059593673 9:115692733-115692755 CCTTAGAAATGCTATGGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059593670 Original CRISPR TCTAAGGCCTCTCTTCTAAG AGG (reversed) Intergenic
No off target data available for this crispr