ID: 1059596000

View in Genome Browser
Species Human (GRCh38)
Location 9:115721279-115721301
Sequence TTAAAATGGGAAGATTACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059596000_1059596004 19 Left 1059596000 9:115721279-115721301 CCAGGGTAATCTTCCCATTTTAA No data
Right 1059596004 9:115721321-115721343 TCTGAGAAATCCTTTCTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059596000 Original CRISPR TTAAAATGGGAAGATTACCC TGG (reversed) Intergenic
No off target data available for this crispr