ID: 1059596001

View in Genome Browser
Species Human (GRCh38)
Location 9:115721292-115721314
Sequence TAATTTACGGATCTTAAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059596001_1059596004 6 Left 1059596001 9:115721292-115721314 CCCATTTTAAGATCCGTAAATTA No data
Right 1059596004 9:115721321-115721343 TCTGAGAAATCCTTTCTGCTAGG No data
1059596001_1059596006 22 Left 1059596001 9:115721292-115721314 CCCATTTTAAGATCCGTAAATTA No data
Right 1059596006 9:115721337-115721359 TGCTAGGTAATGTATTACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059596001 Original CRISPR TAATTTACGGATCTTAAAAT GGG (reversed) Intergenic
No off target data available for this crispr