ID: 1059596002

View in Genome Browser
Species Human (GRCh38)
Location 9:115721293-115721315
Sequence TTAATTTACGGATCTTAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059596002_1059596006 21 Left 1059596002 9:115721293-115721315 CCATTTTAAGATCCGTAAATTAA No data
Right 1059596006 9:115721337-115721359 TGCTAGGTAATGTATTACTCAGG No data
1059596002_1059596004 5 Left 1059596002 9:115721293-115721315 CCATTTTAAGATCCGTAAATTAA No data
Right 1059596004 9:115721321-115721343 TCTGAGAAATCCTTTCTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059596002 Original CRISPR TTAATTTACGGATCTTAAAA TGG (reversed) Intergenic
No off target data available for this crispr