ID: 1059596003

View in Genome Browser
Species Human (GRCh38)
Location 9:115721305-115721327
Sequence TCTCAGATGTGATTAATTTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059596003_1059596007 23 Left 1059596003 9:115721305-115721327 CCGTAAATTAATCACATCTGAGA No data
Right 1059596007 9:115721351-115721373 TTACTCAGGTAATGTATTCACGG No data
1059596003_1059596006 9 Left 1059596003 9:115721305-115721327 CCGTAAATTAATCACATCTGAGA No data
Right 1059596006 9:115721337-115721359 TGCTAGGTAATGTATTACTCAGG No data
1059596003_1059596008 24 Left 1059596003 9:115721305-115721327 CCGTAAATTAATCACATCTGAGA No data
Right 1059596008 9:115721352-115721374 TACTCAGGTAATGTATTCACGGG No data
1059596003_1059596009 30 Left 1059596003 9:115721305-115721327 CCGTAAATTAATCACATCTGAGA No data
Right 1059596009 9:115721358-115721380 GGTAATGTATTCACGGGTATAGG No data
1059596003_1059596004 -7 Left 1059596003 9:115721305-115721327 CCGTAAATTAATCACATCTGAGA No data
Right 1059596004 9:115721321-115721343 TCTGAGAAATCCTTTCTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059596003 Original CRISPR TCTCAGATGTGATTAATTTA CGG (reversed) Intergenic
No off target data available for this crispr