ID: 1059596004

View in Genome Browser
Species Human (GRCh38)
Location 9:115721321-115721343
Sequence TCTGAGAAATCCTTTCTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059596002_1059596004 5 Left 1059596002 9:115721293-115721315 CCATTTTAAGATCCGTAAATTAA No data
Right 1059596004 9:115721321-115721343 TCTGAGAAATCCTTTCTGCTAGG No data
1059596003_1059596004 -7 Left 1059596003 9:115721305-115721327 CCGTAAATTAATCACATCTGAGA No data
Right 1059596004 9:115721321-115721343 TCTGAGAAATCCTTTCTGCTAGG No data
1059596001_1059596004 6 Left 1059596001 9:115721292-115721314 CCCATTTTAAGATCCGTAAATTA No data
Right 1059596004 9:115721321-115721343 TCTGAGAAATCCTTTCTGCTAGG No data
1059596000_1059596004 19 Left 1059596000 9:115721279-115721301 CCAGGGTAATCTTCCCATTTTAA No data
Right 1059596004 9:115721321-115721343 TCTGAGAAATCCTTTCTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059596004 Original CRISPR TCTGAGAAATCCTTTCTGCT AGG Intergenic
No off target data available for this crispr