ID: 1059596006

View in Genome Browser
Species Human (GRCh38)
Location 9:115721337-115721359
Sequence TGCTAGGTAATGTATTACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059596003_1059596006 9 Left 1059596003 9:115721305-115721327 CCGTAAATTAATCACATCTGAGA No data
Right 1059596006 9:115721337-115721359 TGCTAGGTAATGTATTACTCAGG No data
1059596002_1059596006 21 Left 1059596002 9:115721293-115721315 CCATTTTAAGATCCGTAAATTAA No data
Right 1059596006 9:115721337-115721359 TGCTAGGTAATGTATTACTCAGG No data
1059596001_1059596006 22 Left 1059596001 9:115721292-115721314 CCCATTTTAAGATCCGTAAATTA No data
Right 1059596006 9:115721337-115721359 TGCTAGGTAATGTATTACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059596006 Original CRISPR TGCTAGGTAATGTATTACTC AGG Intergenic
No off target data available for this crispr