ID: 1059596007

View in Genome Browser
Species Human (GRCh38)
Location 9:115721351-115721373
Sequence TTACTCAGGTAATGTATTCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059596003_1059596007 23 Left 1059596003 9:115721305-115721327 CCGTAAATTAATCACATCTGAGA No data
Right 1059596007 9:115721351-115721373 TTACTCAGGTAATGTATTCACGG No data
1059596005_1059596007 -3 Left 1059596005 9:115721331-115721353 CCTTTCTGCTAGGTAATGTATTA No data
Right 1059596007 9:115721351-115721373 TTACTCAGGTAATGTATTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059596007 Original CRISPR TTACTCAGGTAATGTATTCA CGG Intergenic
No off target data available for this crispr