ID: 1059598167

View in Genome Browser
Species Human (GRCh38)
Location 9:115745661-115745683
Sequence TTGGTACAGAACCTTTTTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059598164_1059598167 15 Left 1059598164 9:115745623-115745645 CCTATGGTCTATGGTTGCTTTGC No data
Right 1059598167 9:115745661-115745683 TTGGTACAGAACCTTTTTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059598167 Original CRISPR TTGGTACAGAACCTTTTTAT AGG Intergenic
No off target data available for this crispr