ID: 1059598818

View in Genome Browser
Species Human (GRCh38)
Location 9:115753496-115753518
Sequence TGTTCTGCTTAGAAATGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059598813_1059598818 28 Left 1059598813 9:115753445-115753467 CCTTGACTGAAAACATCTCGAAA No data
Right 1059598818 9:115753496-115753518 TGTTCTGCTTAGAAATGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059598818 Original CRISPR TGTTCTGCTTAGAAATGCAG AGG Intergenic
No off target data available for this crispr