ID: 1059600807

View in Genome Browser
Species Human (GRCh38)
Location 9:115776329-115776351
Sequence GGTTTTCTTGGGAGACAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059600797_1059600807 22 Left 1059600797 9:115776284-115776306 CCAGCTTGCCAATTTATCTAGAA No data
Right 1059600807 9:115776329-115776351 GGTTTTCTTGGGAGACAAGCAGG No data
1059600798_1059600807 14 Left 1059600798 9:115776292-115776314 CCAATTTATCTAGAATTATGTTT No data
Right 1059600807 9:115776329-115776351 GGTTTTCTTGGGAGACAAGCAGG No data
1059600801_1059600807 -10 Left 1059600801 9:115776316-115776338 CCTCCAGACCCTGGGTTTTCTTG No data
Right 1059600807 9:115776329-115776351 GGTTTTCTTGGGAGACAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059600807 Original CRISPR GGTTTTCTTGGGAGACAAGC AGG Intergenic
No off target data available for this crispr