ID: 1059602845

View in Genome Browser
Species Human (GRCh38)
Location 9:115800160-115800182
Sequence GTTCTAGGCACTCTAAAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059602845_1059602851 -5 Left 1059602845 9:115800160-115800182 CCTACTTTTAGAGTGCCTAGAAC No data
Right 1059602851 9:115800178-115800200 AGAACTTTGGGAGATGGAAAGGG No data
1059602845_1059602854 7 Left 1059602845 9:115800160-115800182 CCTACTTTTAGAGTGCCTAGAAC No data
Right 1059602854 9:115800190-115800212 GATGGAAAGGGTGAATAGAGGGG No data
1059602845_1059602852 5 Left 1059602845 9:115800160-115800182 CCTACTTTTAGAGTGCCTAGAAC No data
Right 1059602852 9:115800188-115800210 GAGATGGAAAGGGTGAATAGAGG No data
1059602845_1059602853 6 Left 1059602845 9:115800160-115800182 CCTACTTTTAGAGTGCCTAGAAC No data
Right 1059602853 9:115800189-115800211 AGATGGAAAGGGTGAATAGAGGG No data
1059602845_1059602855 24 Left 1059602845 9:115800160-115800182 CCTACTTTTAGAGTGCCTAGAAC No data
Right 1059602855 9:115800207-115800229 GAGGGGAAAAAAGACAGAAATGG No data
1059602845_1059602850 -6 Left 1059602845 9:115800160-115800182 CCTACTTTTAGAGTGCCTAGAAC No data
Right 1059602850 9:115800177-115800199 TAGAACTTTGGGAGATGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059602845 Original CRISPR GTTCTAGGCACTCTAAAAGT AGG (reversed) Intergenic
No off target data available for this crispr