ID: 1059603904

View in Genome Browser
Species Human (GRCh38)
Location 9:115812391-115812413
Sequence TAGGTACACCATAATGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059603901_1059603904 -7 Left 1059603901 9:115812375-115812397 CCATCTCCTTTGATCTTAGGTAC No data
Right 1059603904 9:115812391-115812413 TAGGTACACCATAATGAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059603904 Original CRISPR TAGGTACACCATAATGAGGT AGG Intergenic
No off target data available for this crispr