ID: 1059610420

View in Genome Browser
Species Human (GRCh38)
Location 9:115886544-115886566
Sequence ATGTCCTTTTTGAACAGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059610415_1059610420 2 Left 1059610415 9:115886519-115886541 CCTTTCCATCTGCTCCAGTTGTC No data
Right 1059610420 9:115886544-115886566 ATGTCCTTTTTGAACAGTGGTGG No data
1059610416_1059610420 -3 Left 1059610416 9:115886524-115886546 CCATCTGCTCCAGTTGTCCAATG No data
Right 1059610420 9:115886544-115886566 ATGTCCTTTTTGAACAGTGGTGG No data
1059610414_1059610420 3 Left 1059610414 9:115886518-115886540 CCCTTTCCATCTGCTCCAGTTGT No data
Right 1059610420 9:115886544-115886566 ATGTCCTTTTTGAACAGTGGTGG No data
1059610413_1059610420 4 Left 1059610413 9:115886517-115886539 CCCCTTTCCATCTGCTCCAGTTG No data
Right 1059610420 9:115886544-115886566 ATGTCCTTTTTGAACAGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059610420 Original CRISPR ATGTCCTTTTTGAACAGTGG TGG Intergenic
No off target data available for this crispr