ID: 1059615312

View in Genome Browser
Species Human (GRCh38)
Location 9:115944464-115944486
Sequence AAGTATCAGCAGCTGGACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059615312_1059615315 1 Left 1059615312 9:115944464-115944486 CCAGTGTCCAGCTGCTGATACTT No data
Right 1059615315 9:115944488-115944510 TCTTGAAATTTCTAAGTGCAGGG No data
1059615312_1059615316 20 Left 1059615312 9:115944464-115944486 CCAGTGTCCAGCTGCTGATACTT No data
Right 1059615316 9:115944507-115944529 AGGGCTGCAATCAAAGCATCAGG No data
1059615312_1059615314 0 Left 1059615312 9:115944464-115944486 CCAGTGTCCAGCTGCTGATACTT No data
Right 1059615314 9:115944487-115944509 ATCTTGAAATTTCTAAGTGCAGG No data
1059615312_1059615317 21 Left 1059615312 9:115944464-115944486 CCAGTGTCCAGCTGCTGATACTT No data
Right 1059615317 9:115944508-115944530 GGGCTGCAATCAAAGCATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059615312 Original CRISPR AAGTATCAGCAGCTGGACAC TGG (reversed) Intergenic
No off target data available for this crispr