ID: 1059615312 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:115944464-115944486 |
Sequence | AAGTATCAGCAGCTGGACAC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1059615312_1059615315 | 1 | Left | 1059615312 | 9:115944464-115944486 | CCAGTGTCCAGCTGCTGATACTT | No data | ||
Right | 1059615315 | 9:115944488-115944510 | TCTTGAAATTTCTAAGTGCAGGG | No data | ||||
1059615312_1059615316 | 20 | Left | 1059615312 | 9:115944464-115944486 | CCAGTGTCCAGCTGCTGATACTT | No data | ||
Right | 1059615316 | 9:115944507-115944529 | AGGGCTGCAATCAAAGCATCAGG | No data | ||||
1059615312_1059615314 | 0 | Left | 1059615312 | 9:115944464-115944486 | CCAGTGTCCAGCTGCTGATACTT | No data | ||
Right | 1059615314 | 9:115944487-115944509 | ATCTTGAAATTTCTAAGTGCAGG | No data | ||||
1059615312_1059615317 | 21 | Left | 1059615312 | 9:115944464-115944486 | CCAGTGTCCAGCTGCTGATACTT | No data | ||
Right | 1059615317 | 9:115944508-115944530 | GGGCTGCAATCAAAGCATCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1059615312 | Original CRISPR | AAGTATCAGCAGCTGGACAC TGG (reversed) | Intergenic | ||
No off target data available for this crispr |