ID: 1059615316

View in Genome Browser
Species Human (GRCh38)
Location 9:115944507-115944529
Sequence AGGGCTGCAATCAAAGCATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059615311_1059615316 21 Left 1059615311 9:115944463-115944485 CCCAGTGTCCAGCTGCTGATACT No data
Right 1059615316 9:115944507-115944529 AGGGCTGCAATCAAAGCATCAGG No data
1059615312_1059615316 20 Left 1059615312 9:115944464-115944486 CCAGTGTCCAGCTGCTGATACTT No data
Right 1059615316 9:115944507-115944529 AGGGCTGCAATCAAAGCATCAGG No data
1059615313_1059615316 13 Left 1059615313 9:115944471-115944493 CCAGCTGCTGATACTTATCTTGA No data
Right 1059615316 9:115944507-115944529 AGGGCTGCAATCAAAGCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059615316 Original CRISPR AGGGCTGCAATCAAAGCATC AGG Intergenic
No off target data available for this crispr