ID: 1059615317 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:115944508-115944530 |
| Sequence | GGGCTGCAATCAAAGCATCA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1059615312_1059615317 | 21 | Left | 1059615312 | 9:115944464-115944486 | CCAGTGTCCAGCTGCTGATACTT | No data | ||
| Right | 1059615317 | 9:115944508-115944530 | GGGCTGCAATCAAAGCATCAGGG | No data | ||||
| 1059615311_1059615317 | 22 | Left | 1059615311 | 9:115944463-115944485 | CCCAGTGTCCAGCTGCTGATACT | No data | ||
| Right | 1059615317 | 9:115944508-115944530 | GGGCTGCAATCAAAGCATCAGGG | No data | ||||
| 1059615313_1059615317 | 14 | Left | 1059615313 | 9:115944471-115944493 | CCAGCTGCTGATACTTATCTTGA | No data | ||
| Right | 1059615317 | 9:115944508-115944530 | GGGCTGCAATCAAAGCATCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1059615317 | Original CRISPR | GGGCTGCAATCAAAGCATCA GGG | Intergenic | ||
| No off target data available for this crispr | |||||