ID: 1059618607

View in Genome Browser
Species Human (GRCh38)
Location 9:115978204-115978226
Sequence GAGGCAATCCAACTGGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059618607_1059618612 20 Left 1059618607 9:115978204-115978226 CCTGTTTCCAGTTGGATTGCCTC No data
Right 1059618612 9:115978247-115978269 AAATCAGAATACTGCTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059618607 Original CRISPR GAGGCAATCCAACTGGAAAC AGG (reversed) Intergenic
No off target data available for this crispr