ID: 1059619041

View in Genome Browser
Species Human (GRCh38)
Location 9:115983315-115983337
Sequence CCTAAGTAACAGTAGAACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059619037_1059619041 17 Left 1059619037 9:115983275-115983297 CCAATGATCTGGAAAAGAATTTC No data
Right 1059619041 9:115983315-115983337 CCTAAGTAACAGTAGAACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059619041 Original CRISPR CCTAAGTAACAGTAGAACTT TGG Intergenic
No off target data available for this crispr