ID: 1059619253

View in Genome Browser
Species Human (GRCh38)
Location 9:115985252-115985274
Sequence ATGTAGAAGGAGAAAACTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059619253_1059619258 20 Left 1059619253 9:115985252-115985274 CCCTCAGTTTTCTCCTTCTACAT No data
Right 1059619258 9:115985295-115985317 GCTATACTTTTATTATATGAGGG No data
1059619253_1059619257 19 Left 1059619253 9:115985252-115985274 CCCTCAGTTTTCTCCTTCTACAT No data
Right 1059619257 9:115985294-115985316 TGCTATACTTTTATTATATGAGG No data
1059619253_1059619256 -9 Left 1059619253 9:115985252-115985274 CCCTCAGTTTTCTCCTTCTACAT No data
Right 1059619256 9:115985266-115985288 CTTCTACATAATGATCAAAAAGG No data
1059619253_1059619259 23 Left 1059619253 9:115985252-115985274 CCCTCAGTTTTCTCCTTCTACAT No data
Right 1059619259 9:115985298-115985320 ATACTTTTATTATATGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059619253 Original CRISPR ATGTAGAAGGAGAAAACTGA GGG (reversed) Intergenic
No off target data available for this crispr