ID: 1059623652

View in Genome Browser
Species Human (GRCh38)
Location 9:116036632-116036654
Sequence TGTGAAGTGTGATTTTAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059623652_1059623655 21 Left 1059623652 9:116036632-116036654 CCTAATTAAAATCACACTTCACA No data
Right 1059623655 9:116036676-116036698 TCTCAGCTCCAAGAATGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059623652 Original CRISPR TGTGAAGTGTGATTTTAATT AGG (reversed) Intergenic