ID: 1059623654

View in Genome Browser
Species Human (GRCh38)
Location 9:116036658-116036680
Sequence TGAGACTAGCATATCCAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059623654_1059623655 -5 Left 1059623654 9:116036658-116036680 CCAAATTGGATATGCTAGTCTCA No data
Right 1059623655 9:116036676-116036698 TCTCAGCTCCAAGAATGTCTTGG No data
1059623654_1059623657 7 Left 1059623654 9:116036658-116036680 CCAAATTGGATATGCTAGTCTCA No data
Right 1059623657 9:116036688-116036710 GAATGTCTTGGAAAAGTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059623654 Original CRISPR TGAGACTAGCATATCCAATT TGG (reversed) Intergenic