ID: 1059628921

View in Genome Browser
Species Human (GRCh38)
Location 9:116098538-116098560
Sequence ATTCTATTGTCAATAAACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059628921_1059628923 1 Left 1059628921 9:116098538-116098560 CCAGAGTTTATTGACAATAGAAT No data
Right 1059628923 9:116098562-116098584 CTTTTAATAGATAACCTCTCGGG No data
1059628921_1059628922 0 Left 1059628921 9:116098538-116098560 CCAGAGTTTATTGACAATAGAAT No data
Right 1059628922 9:116098561-116098583 TCTTTTAATAGATAACCTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059628921 Original CRISPR ATTCTATTGTCAATAAACTC TGG (reversed) Intergenic
No off target data available for this crispr