ID: 1059629258

View in Genome Browser
Species Human (GRCh38)
Location 9:116102344-116102366
Sequence TAATATTACTTTAACTAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059629258_1059629259 -3 Left 1059629258 9:116102344-116102366 CCATGTTAGTTAAAGTAATATTA No data
Right 1059629259 9:116102364-116102386 TTACAGTTCATCTGTAAAATTGG No data
1059629258_1059629260 12 Left 1059629258 9:116102344-116102366 CCATGTTAGTTAAAGTAATATTA No data
Right 1059629260 9:116102379-116102401 AAAATTGGAGAAGAAGAAATTGG No data
1059629258_1059629261 19 Left 1059629258 9:116102344-116102366 CCATGTTAGTTAAAGTAATATTA No data
Right 1059629261 9:116102386-116102408 GAGAAGAAGAAATTGGACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059629258 Original CRISPR TAATATTACTTTAACTAACA TGG (reversed) Intergenic
No off target data available for this crispr