ID: 1059629672

View in Genome Browser
Species Human (GRCh38)
Location 9:116107377-116107399
Sequence TCATTAACAGTGGGACCATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059629672_1059629676 26 Left 1059629672 9:116107377-116107399 CCATATGGTCCCACTGTTAATGA No data
Right 1059629676 9:116107426-116107448 ATCAATAAGCTACTCCTGGCAGG No data
1059629672_1059629675 22 Left 1059629672 9:116107377-116107399 CCATATGGTCCCACTGTTAATGA No data
Right 1059629675 9:116107422-116107444 GAAAATCAATAAGCTACTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059629672 Original CRISPR TCATTAACAGTGGGACCATA TGG (reversed) Intergenic
No off target data available for this crispr