ID: 1059629673

View in Genome Browser
Species Human (GRCh38)
Location 9:116107386-116107408
Sequence TAAACATAATCATTAACAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059629673_1059629676 17 Left 1059629673 9:116107386-116107408 CCCACTGTTAATGATTATGTTTA No data
Right 1059629676 9:116107426-116107448 ATCAATAAGCTACTCCTGGCAGG No data
1059629673_1059629675 13 Left 1059629673 9:116107386-116107408 CCCACTGTTAATGATTATGTTTA No data
Right 1059629675 9:116107422-116107444 GAAAATCAATAAGCTACTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059629673 Original CRISPR TAAACATAATCATTAACAGT GGG (reversed) Intergenic
No off target data available for this crispr