ID: 1059629676

View in Genome Browser
Species Human (GRCh38)
Location 9:116107426-116107448
Sequence ATCAATAAGCTACTCCTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059629674_1059629676 16 Left 1059629674 9:116107387-116107409 CCACTGTTAATGATTATGTTTAC No data
Right 1059629676 9:116107426-116107448 ATCAATAAGCTACTCCTGGCAGG No data
1059629672_1059629676 26 Left 1059629672 9:116107377-116107399 CCATATGGTCCCACTGTTAATGA No data
Right 1059629676 9:116107426-116107448 ATCAATAAGCTACTCCTGGCAGG No data
1059629673_1059629676 17 Left 1059629673 9:116107386-116107408 CCCACTGTTAATGATTATGTTTA No data
Right 1059629676 9:116107426-116107448 ATCAATAAGCTACTCCTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059629676 Original CRISPR ATCAATAAGCTACTCCTGGC AGG Intergenic
No off target data available for this crispr