ID: 1059629802

View in Genome Browser
Species Human (GRCh38)
Location 9:116109023-116109045
Sequence GGGAGCTCTAAAATGATATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059629802_1059629809 8 Left 1059629802 9:116109023-116109045 CCAAATATCATTTTAGAGCTCCC No data
Right 1059629809 9:116109054-116109076 CACGTGTTGTGGCAGGAACATGG No data
1059629802_1059629804 -3 Left 1059629802 9:116109023-116109045 CCAAATATCATTTTAGAGCTCCC No data
Right 1059629804 9:116109043-116109065 CCCATAATTCCCACGTGTTGTGG 0: 462
1: 2500
2: 3998
3: 4278
4: 5300
1059629802_1059629806 1 Left 1059629802 9:116109023-116109045 CCAAATATCATTTTAGAGCTCCC No data
Right 1059629806 9:116109047-116109069 TAATTCCCACGTGTTGTGGCAGG No data
1059629802_1059629810 11 Left 1059629802 9:116109023-116109045 CCAAATATCATTTTAGAGCTCCC No data
Right 1059629810 9:116109057-116109079 GTGTTGTGGCAGGAACATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059629802 Original CRISPR GGGAGCTCTAAAATGATATT TGG (reversed) Intergenic
No off target data available for this crispr