ID: 1059632095

View in Genome Browser
Species Human (GRCh38)
Location 9:116135705-116135727
Sequence CTGCCTCTTGATATGATGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059632095_1059632097 0 Left 1059632095 9:116135705-116135727 CCTGGCATCATATCAAGAGGCAG No data
Right 1059632097 9:116135728-116135750 CCCAGTTCTAAATGATATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059632095 Original CRISPR CTGCCTCTTGATATGATGCC AGG (reversed) Intergenic
No off target data available for this crispr