ID: 1059633507

View in Genome Browser
Species Human (GRCh38)
Location 9:116150694-116150716
Sequence CCTGAGGATTTTTTCCTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059633507_1059633514 -2 Left 1059633507 9:116150694-116150716 CCTTTTAGGAAAAAATCCTCAGG No data
Right 1059633514 9:116150715-116150737 GGAACTTAAGGGAGTCCCTGGGG No data
1059633507_1059633517 5 Left 1059633507 9:116150694-116150716 CCTTTTAGGAAAAAATCCTCAGG No data
Right 1059633517 9:116150722-116150744 AAGGGAGTCCCTGGGGAGGAGGG No data
1059633507_1059633522 17 Left 1059633507 9:116150694-116150716 CCTTTTAGGAAAAAATCCTCAGG No data
Right 1059633522 9:116150734-116150756 GGGGAGGAGGGCTGGAAGGAAGG No data
1059633507_1059633520 13 Left 1059633507 9:116150694-116150716 CCTTTTAGGAAAAAATCCTCAGG No data
Right 1059633520 9:116150730-116150752 CCCTGGGGAGGAGGGCTGGAAGG No data
1059633507_1059633515 1 Left 1059633507 9:116150694-116150716 CCTTTTAGGAAAAAATCCTCAGG No data
Right 1059633515 9:116150718-116150740 ACTTAAGGGAGTCCCTGGGGAGG No data
1059633507_1059633516 4 Left 1059633507 9:116150694-116150716 CCTTTTAGGAAAAAATCCTCAGG No data
Right 1059633516 9:116150721-116150743 TAAGGGAGTCCCTGGGGAGGAGG No data
1059633507_1059633518 9 Left 1059633507 9:116150694-116150716 CCTTTTAGGAAAAAATCCTCAGG No data
Right 1059633518 9:116150726-116150748 GAGTCCCTGGGGAGGAGGGCTGG No data
1059633507_1059633513 -3 Left 1059633507 9:116150694-116150716 CCTTTTAGGAAAAAATCCTCAGG No data
Right 1059633513 9:116150714-116150736 AGGAACTTAAGGGAGTCCCTGGG No data
1059633507_1059633512 -4 Left 1059633507 9:116150694-116150716 CCTTTTAGGAAAAAATCCTCAGG No data
Right 1059633512 9:116150713-116150735 CAGGAACTTAAGGGAGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059633507 Original CRISPR CCTGAGGATTTTTTCCTAAA AGG (reversed) Intergenic
No off target data available for this crispr