ID: 1059633516

View in Genome Browser
Species Human (GRCh38)
Location 9:116150721-116150743
Sequence TAAGGGAGTCCCTGGGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059633507_1059633516 4 Left 1059633507 9:116150694-116150716 CCTTTTAGGAAAAAATCCTCAGG No data
Right 1059633516 9:116150721-116150743 TAAGGGAGTCCCTGGGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059633516 Original CRISPR TAAGGGAGTCCCTGGGGAGG AGG Intergenic
No off target data available for this crispr